Transcript: Human XM_005252316.5

PREDICTED: Homo sapiens gamma-aminobutyric acid type B receptor subunit 2 (GABBR2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GABBR2 (9568)
Length:
4799
CDS:
268..2319

Additional Resources:

NCBI RefSeq record:
XM_005252316.5
NBCI Gene record:
GABBR2 (9568)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005252316.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240423 CTCATGTTGTTCGGTTGTTTC pLKO_005 1492 CDS 100% 10.800 15.120 N LOC100045048 n/a
2 TRCN0000011597 CCGGAATCAGAAGCTCATAAA pLKO.1 1011 CDS 100% 13.200 9.240 N GABBR2 n/a
3 TRCN0000367708 GAGAACATGTATGGTAGTAAA pLKO_005 301 CDS 100% 13.200 9.240 N GABBR2 n/a
4 TRCN0000011599 GCACTGTGAGAACACCCATAT pLKO.1 1431 CDS 100% 10.800 7.560 N GABBR2 n/a
5 TRCN0000011595 GCCTTATTTGTGAAGTCCTTA pLKO.1 2506 3UTR 100% 4.950 3.465 N GABBR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005252316.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11390 pDONR223 100% 77.3% 77.2% None 0_1ins600;1616G>A n/a
2 ccsbBroad304_11390 pLX_304 0% 77.3% 77.2% V5 0_1ins600;1616G>A n/a
3 TRCN0000474183 CAAGGCTTTTGAGAGGACTGGAAC pLX_317 3.4% 77.3% 77.2% V5 0_1ins600;1616G>A n/a
4 TRCN0000489201 CGAACGTACCCACTCGCACTACCT pLX_317 13.7% 77.2% 77.2% V5 0_1ins600;1758T>C;2049_2050insG n/a
Download CSV