Transcript: Human XM_005255858.3

PREDICTED: Homo sapiens zinc finger CCHC-type containing 14 (ZCCHC14), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZCCHC14 (23174)
Length:
3113
CDS:
219..3107

Additional Resources:

NCBI RefSeq record:
XM_005255858.3
NBCI Gene record:
ZCCHC14 (23174)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005255858.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033785 CGGGAACCTATCTTGTTACAA pLKO.1 2927 CDS 100% 5.625 4.500 N ZCCHC14 n/a
2 TRCN0000291853 CGGGAACCTATCTTGTTACAA pLKO_005 2927 CDS 100% 5.625 4.500 N ZCCHC14 n/a
3 TRCN0000033784 CCTGTCCTAATAATGTGCAAA pLKO.1 2185 CDS 100% 4.950 3.960 N ZCCHC14 n/a
4 TRCN0000291777 CCTGTCCTAATAATGTGCAAA pLKO_005 2185 CDS 100% 4.950 3.960 N ZCCHC14 n/a
5 TRCN0000033786 CCTCTGAAGTGACGGAATTTA pLKO.1 619 CDS 100% 15.000 10.500 N ZCCHC14 n/a
6 TRCN0000291778 CCTCTGAAGTGACGGAATTTA pLKO_005 619 CDS 100% 15.000 10.500 N ZCCHC14 n/a
7 TRCN0000033788 GTCAGTAATAGTTTGGAGAAT pLKO.1 411 CDS 100% 4.950 3.465 N ZCCHC14 n/a
8 TRCN0000291779 GTCAGTAATAGTTTGGAGAAT pLKO_005 411 CDS 100% 4.950 3.465 N ZCCHC14 n/a
9 TRCN0000033787 CCTCCCTTTCTAAAGTAGGTA pLKO.1 865 CDS 100% 3.000 2.100 N ZCCHC14 n/a
10 TRCN0000291780 CCTCCCTTTCTAAAGTAGGTA pLKO_005 865 CDS 100% 3.000 2.100 N ZCCHC14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005255858.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07847 pDONR223 100% 97.4% 97% None (many diffs) n/a
2 ccsbBroad304_07847 pLX_304 0% 97.4% 97% V5 (many diffs) n/a
3 TRCN0000480314 GACAGTCTCCGACTGGGCACGTGT pLX_317 13.5% 97.4% 97% V5 (many diffs) n/a
Download CSV