Transcript: Human XM_005257242.4

PREDICTED: Homo sapiens caveolae associated protein 1 (CAVIN1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAVIN1 (284119)
Length:
1527
CDS:
173..850

Additional Resources:

NCBI RefSeq record:
XM_005257242.4
NBCI Gene record:
CAVIN1 (284119)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257242.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053058 CCGCAACTTTAAAGTCATGAT pLKO.1 616 CDS 100% 4.950 6.930 N CAVIN1 n/a
2 TRCN0000306090 AGGTCAGCGTCAACGTGAAGA pLKO_005 519 CDS 100% 4.950 3.465 N Cavin1 n/a
3 TRCN0000438026 CAATACGGTGAGCAAGCTGCT pLKO_005 484 CDS 100% 2.160 1.296 N CAVIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257242.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09954 pDONR223 100% 50.7% 41.7% None (many diffs) n/a
2 ccsbBroad304_09954 pLX_304 0% 50.7% 41.7% V5 (many diffs) n/a
3 TRCN0000475656 GTCAGAGCATTTCGTGACATGCTT pLX_317 18% 50.7% 41.7% V5 (many diffs) n/a
Download CSV