Transcript: Human XM_005257468.5

PREDICTED: Homo sapiens mbt domain containing 1 (MBTD1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MBTD1 (54799)
Length:
2171
CDS:
216..2171

Additional Resources:

NCBI RefSeq record:
XM_005257468.5
NBCI Gene record:
MBTD1 (54799)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257468.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151070 GCCACAGTAACTCGAATTATT pLKO.1 1818 CDS 100% 15.000 21.000 N MBTD1 n/a
2 TRCN0000323079 GCCACAGTAACTCGAATTATT pLKO_005 1818 CDS 100% 15.000 21.000 N MBTD1 n/a
3 TRCN0000323080 GCCCATTAATACATCATATTG pLKO_005 1288 CDS 100% 13.200 18.480 N MBTD1 n/a
4 TRCN0000150313 CTCCTAGAACTATTCAGCATA pLKO.1 1015 CDS 100% 4.950 3.960 N MBTD1 n/a
5 TRCN0000154234 CCTCCTAGAACTATTCAGCAT pLKO.1 1014 CDS 100% 2.640 2.112 N MBTD1 n/a
6 TRCN0000323082 GGAAGCTATAGACCCATTAAA pLKO_005 1454 CDS 100% 15.000 10.500 N MBTD1 n/a
7 TRCN0000323011 TCTCATGGAGCCACGTTTAAT pLKO_005 1790 CDS 100% 15.000 10.500 N MBTD1 n/a
8 TRCN0000097657 CGTGTAGGAATGAAATTAGAA pLKO.1 1761 CDS 100% 5.625 3.938 N Mbtd1 n/a
9 TRCN0000152974 GCAACCATTAGAAAGGTGCTA pLKO.1 1494 CDS 100% 2.640 1.848 N MBTD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257468.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12084 pDONR223 100% 62.4% 61.1% None (many diffs) n/a
2 ccsbBroad304_12084 pLX_304 0% 62.4% 61.1% V5 (many diffs) n/a
3 TRCN0000479991 GTTTCTTTAGCCCCGACTGTGCAG pLX_317 25.9% 62.4% 61.1% V5 (many diffs) n/a
Download CSV