Transcript: Human XM_005258081.4

PREDICTED: Homo sapiens adenylate cyclase activating polypeptide 1 (ADCYAP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADCYAP1 (116)
Length:
3544
CDS:
60..1007

Additional Resources:

NCBI RefSeq record:
XM_005258081.4
NBCI Gene record:
ADCYAP1 (116)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005258081.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078377 ACGCCGAATAGCTTATTTGTA pLKO.1 986 CDS 100% 5.625 7.875 N ADCYAP1 n/a
2 TRCN0000371180 ATACTTTGTGGACCAATTATT pLKO_005 1198 3UTR 100% 15.000 10.500 N ADCYAP1 n/a
3 TRCN0000371228 GTTCTATCCAAACATGTATTT pLKO_005 1094 3UTR 100% 13.200 9.240 N ADCYAP1 n/a
4 TRCN0000371227 TTAACGAGGCCTACCGCAAAG pLKO_005 739 CDS 100% 6.000 4.200 N ADCYAP1 n/a
5 TRCN0000078373 GCCTGAAGATATTACTACTTA pLKO.1 1444 3UTR 100% 5.625 3.938 N ADCYAP1 n/a
6 TRCN0000078374 GCTGGTCTATGGGATAATCAT pLKO.1 509 CDS 100% 5.625 3.938 N ADCYAP1 n/a
7 TRCN0000222700 CGGGATCTTCACGGACAGCTA pLKO.1 878 CDS 100% 0.880 0.616 N ADCYAP1 n/a
8 TRCN0000078375 GAGGTATAAACAAAGGGTTAA pLKO.1 956 CDS 100% 10.800 6.480 N ADCYAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005258081.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00025 pDONR223 100% 55.8% 55.8% None 1_417del n/a
2 ccsbBroad304_00025 pLX_304 0% 55.8% 55.8% V5 1_417del n/a
3 TRCN0000479898 TTAACCAATCCCAATATTTGCCAA pLX_317 62.4% 55.8% 55.8% V5 1_417del n/a
4 TRCN0000488695 GTGAATATTCCGCACACTGGACCA pLX_317 62.2% 55.7% 55.8% V5 (not translated due to prior stop codon) 1_417del;543G>A n/a
Download CSV