Transcript: Human XM_005259262.3

PREDICTED: Homo sapiens gem nuclear organelle associated protein 7 (GEMIN7), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GEMIN7 (79760)
Length:
1169
CDS:
366..761

Additional Resources:

NCBI RefSeq record:
XM_005259262.3
NBCI Gene record:
GEMIN7 (79760)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005259262.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142574 GAACTCTGAACCCTACAGAAA pLKO.1 986 3UTR 100% 4.950 6.930 N GEMIN7 n/a
2 TRCN0000139760 CTGCTCCGATGTAGTGACATT pLKO.1 717 CDS 100% 4.950 3.960 N GEMIN7 n/a
3 TRCN0000433193 GTGTCCCATAGCTCAAGAATC pLKO_005 494 CDS 100% 10.800 7.560 N GEMIN7 n/a
4 TRCN0000140667 CTTGAGGCTAAGGCACTGTAT pLKO.1 784 3UTR 100% 4.950 3.465 N GEMIN7 n/a
5 TRCN0000140333 CCCATTGGAAGGAATGCTCTA pLKO.1 958 3UTR 100% 4.050 2.835 N GEMIN7 n/a
6 TRCN0000140373 GAAATCCAGGAGTGTCCCATA pLKO.1 483 CDS 100% 4.050 2.835 N GEMIN7 n/a
7 TRCN0000413283 TTATGAGCTCCCTTGGAATTT pLKO_005 853 3UTR 100% 13.200 7.920 N GEMIN7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005259262.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04120 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04120 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471137 CCTCCCCTATAAGAAAGGCACTCA pLX_317 100% 100% 100% V5 n/a
Download CSV