Transcript: Human XM_005259861.3

PREDICTED: Homo sapiens solute carrier family 25 member 42 (SLC25A42), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC25A42 (284439)
Length:
3226
CDS:
251..1207

Additional Resources:

NCBI RefSeq record:
XM_005259861.3
NBCI Gene record:
SLC25A42 (284439)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005259861.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141106 CTACAAAGGCTTGAGCATGAA pLKO.1 1102 CDS 100% 4.950 3.960 N SLC25A42 n/a
2 TRCN0000139515 CTTCACCTATGAGACGCTCAA pLKO.1 865 CDS 100% 4.050 3.240 N SLC25A42 n/a
3 TRCN0000139858 CAAGAGCTTGCACAGAGAGTA pLKO.1 883 CDS 100% 4.950 3.465 N SLC25A42 n/a
4 TRCN0000110849 CAGCAACATCTTTCATGTCTT pLKO.1 751 CDS 100% 4.950 3.465 N Slc25a42 n/a
5 TRCN0000144548 CAGCAACATCTTTCATGTCTT pLKO.1 751 CDS 100% 4.950 3.465 N SLC25A42 n/a
6 TRCN0000139133 CCTGAGCTTCTTCACCTATGA pLKO.1 856 CDS 100% 4.950 3.465 N SLC25A42 n/a
7 TRCN0000145296 GTACAGCAACATCTTTCATGT pLKO.1 748 CDS 100% 4.950 3.465 N SLC25A42 n/a
8 TRCN0000139833 CCTCTACTACACCTACCTCAA pLKO.1 478 CDS 100% 4.050 2.835 N SLC25A42 n/a
9 TRCN0000139172 CCCGAAGGAAATGTACAGCAA pLKO.1 736 CDS 100% 2.640 1.848 N SLC25A42 n/a
10 TRCN0000142379 GAAGACTCTCTACCATGGATT pLKO.1 799 CDS 100% 4.950 2.970 N SLC25A42 n/a
11 TRCN0000142274 GTGAGACCAAATGAGTGGATT pLKO.1 2887 3UTR 100% 4.950 2.970 N SLC25A42 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005259861.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09964 pDONR223 100% 99.7% 99.3% None 115T>C;934C>A n/a
2 ccsbBroad304_09964 pLX_304 0% 99.7% 99.3% V5 115T>C;934C>A n/a
3 TRCN0000477065 TTGGAGACCAACTTCGTAATGTTG pLX_317 36.7% 99.7% 99.3% V5 115T>C;934C>A n/a
Download CSV