Transcript: Human XM_005259952.4

PREDICTED: Homo sapiens zinc finger protein 562 (ZNF562), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF562 (54811)
Length:
2067
CDS:
496..1347

Additional Resources:

NCBI RefSeq record:
XM_005259952.4
NBCI Gene record:
ZNF562 (54811)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005259952.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285213 CAATAGATCTTCAACGCTTAC pLKO_005 1209 CDS 100% 6.000 8.400 N ZNF562 n/a
2 TRCN0000274446 CCTTGCTGTGCATCTTGAAAT pLKO_005 636 CDS 100% 13.200 9.240 N ZNF562 n/a
3 TRCN0000274447 TATGAGTGTTGTTACCATTTA pLKO_005 1516 3UTR 100% 13.200 9.240 N ZNF562 n/a
4 TRCN0000274445 TCACAGTGGAGAAAGGTAAAT pLKO_005 1329 CDS 100% 13.200 9.240 N ZNF562 n/a
5 TRCN0000015459 CATCACAACTTCCTCACACTT pLKO.1 786 CDS 100% 4.950 3.465 N ZNF562 n/a
6 TRCN0000274397 CATCACAACTTCCTCACACTT pLKO_005 786 CDS 100% 4.950 3.465 N ZNF562 n/a
7 TRCN0000015462 CCATCGTAGTAAACATTTGAA pLKO.1 1305 CDS 100% 5.625 3.375 N ZNF562 n/a
8 TRCN0000151775 CCCTATGAATGTAAGGAATGT pLKO.1 1093 CDS 100% 4.950 2.475 Y ZNF829 n/a
9 TRCN0000160334 CCTATGAATGTAAGGAATGTA pLKO.1 1094 CDS 100% 5.625 2.813 Y ZNF570 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005259952.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03461 pDONR223 100% 66.4% 66.4% None 0_1ins429 n/a
2 ccsbBroad304_03461 pLX_304 0% 66.4% 66.4% V5 0_1ins429 n/a
3 TRCN0000466378 TGATTTCAACACTTCATTTTCAGG pLX_317 29.2% 66.4% 66.4% V5 0_1ins429 n/a
4 ccsbBroadEn_12992 pDONR223 100% 63% 58.7% None (many diffs) n/a
5 ccsbBroad304_12992 pLX_304 0% 63% 58.7% V5 (many diffs) n/a
6 TRCN0000470490 CAAGAATAGAAAATAGCTAACTTC pLX_317 40.7% 63% 58.7% V5 (many diffs) n/a
Download CSV