Transcript: Human XM_005260804.2

PREDICTED: Homo sapiens PC-esterase domain containing 1A (PCED1A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCED1A (64773)
Length:
1905
CDS:
400..1764

Additional Resources:

NCBI RefSeq record:
XM_005260804.2
NBCI Gene record:
PCED1A (64773)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005260804.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130377 GAGACTGATCCACACATACAA pLKO.1 1698 CDS 100% 5.625 7.875 N PCED1A n/a
2 TRCN0000338738 GAGACTGATCCACACATACAA pLKO_005 1698 CDS 100% 5.625 7.875 N PCED1A n/a
3 TRCN0000128528 CTTCAACTATAATCCAGTGGA pLKO.1 1470 CDS 100% 2.640 3.696 N PCED1A n/a
4 TRCN0000129494 GAACTTCTACAGTGCTACGCT pLKO.1 1038 CDS 100% 0.750 0.600 N PCED1A n/a
5 TRCN0000130092 CTACTTCCTCACTCGTGTTTA pLKO.1 729 CDS 100% 13.200 9.240 N PCED1A n/a
6 TRCN0000338670 CTACTTCCTCACTCGTGTTTA pLKO_005 729 CDS 100% 13.200 9.240 N PCED1A n/a
7 TRCN0000130992 CAGAAAGACTCACTGCTCACA pLKO.1 562 CDS 100% 2.640 1.848 N PCED1A n/a
8 TRCN0000338669 CAGAAAGACTCACTGCTCACA pLKO_005 562 CDS 100% 2.640 1.848 N PCED1A n/a
9 TRCN0000129522 GCTGCTACACAACAAGTTCGT pLKO.1 483 CDS 100% 2.640 1.848 N PCED1A n/a
10 TRCN0000338668 GCTGCTACACAACAAGTTCGT pLKO_005 483 CDS 100% 2.640 1.848 N PCED1A n/a
11 TRCN0000131185 GCTACACAACAAGTTCGTGGT pLKO.1 486 CDS 100% 2.160 1.512 N PCED1A n/a
12 TRCN0000129588 CACTCGTGTTTACTCCGAGTA pLKO.1 738 CDS 100% 0.405 0.284 N PCED1A n/a
13 TRCN0000129108 CACACATACAAACTGGACAGA pLKO.1 1708 CDS 100% 2.640 1.584 N PCED1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005260804.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03965 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03965 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480929 CCAGCATTACTCGATATCGGTGCA pLX_317 28% 100% 100% V5 n/a
4 ccsbBroadEn_12488 pDONR223 100% 68.6% 68.5% None 203_355del;758C>T;788_1060del n/a
5 ccsbBroad304_12488 pLX_304 0% 68.6% 68.5% V5 203_355del;758C>T;788_1060del n/a
6 TRCN0000471857 TTCTCTGACAGATAGAGAATCCTA pLX_317 42.7% 68.6% 68.5% V5 203_355del;758C>T;788_1060del n/a
Download CSV