Transcript: Human XM_005262389.3

PREDICTED: Homo sapiens E74 like ETS transcription factor 4 (ELF4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ELF4 (2000)
Length:
4509
CDS:
722..2713

Additional Resources:

NCBI RefSeq record:
XM_005262389.3
NBCI Gene record:
ELF4 (2000)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262389.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420039 AGGGAATTTACTACCCTATAT pLKO_005 3075 3UTR 100% 13.200 18.480 N ELF4 n/a
2 TRCN0000013869 CGCGGAAGTCTTACTCAATAT pLKO.1 1003 CDS 100% 13.200 18.480 N ELF4 n/a
3 TRCN0000428963 GATCTTCAGTACCTCCGAAAT pLKO_005 1057 CDS 100% 10.800 15.120 N ELF4 n/a
4 TRCN0000013870 GCACTAAGATACTACTACCAA pLKO.1 1523 CDS 100% 3.000 4.200 N ELF4 n/a
5 TRCN0000421262 AGAGGCTGGTGTACCAGTTTA pLKO_005 1572 CDS 100% 13.200 9.240 N ELF4 n/a
6 TRCN0000432889 CATTTCAGTGGGATGTCAATA pLKO_005 2801 3UTR 100% 13.200 9.240 N ELF4 n/a
7 TRCN0000013871 CCCTGATTTACTGCATCTGTA pLKO.1 847 CDS 100% 4.950 3.465 N ELF4 n/a
8 TRCN0000013872 CTCTACTTTCAAGGACACCTT pLKO.1 2071 CDS 100% 2.640 1.848 N ELF4 n/a
9 TRCN0000427971 CAACCCTACTTCCCTCATTAA pLKO_005 2671 CDS 100% 13.200 7.920 N ELF4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262389.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00496 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00496 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468819 TAACAAAACTGAGGTAAACTTTAC pLX_317 4.3% 100% 100% V5 n/a
Download CSV