Transcript: Human XM_005263280.5

PREDICTED: Homo sapiens abraxas 1, BRCA1 A complex subunit (ABRAXAS1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABRAXAS1 (84142)
Length:
2958
CDS:
346..1428

Additional Resources:

NCBI RefSeq record:
XM_005263280.5
NBCI Gene record:
ABRAXAS1 (84142)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005263280.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426063 ATCCTTAAAGGAGGTACATAA pLKO_005 819 CDS 100% 13.200 10.560 N ABRAXAS1 n/a
2 TRCN0000416367 TATTCACGGTCTCCTACATTT pLKO_005 1405 CDS 100% 13.200 9.240 N ABRAXAS1 n/a
3 TRCN0000122051 CCTTGTATGTAACTGGCATAA pLKO.1 2753 3UTR 100% 10.800 7.560 N ABRAXAS1 n/a
4 TRCN0000143855 CATCGACTGGAACATTCCTTA pLKO.1 637 CDS 100% 4.950 3.465 N ABRAXAS1 n/a
5 TRCN0000139032 CCAGTGGAACTCAGAACTGAT pLKO.1 2182 3UTR 100% 4.950 3.465 N ABRAXAS1 n/a
6 TRCN0000145012 GCAATCTGCTTAATGGACATT pLKO.1 2546 3UTR 100% 4.950 3.465 N ABRAXAS1 n/a
7 TRCN0000122344 CAGTACAAACACACAGCTCTA pLKO.1 779 CDS 100% 4.050 2.835 N ABRAXAS1 n/a
8 TRCN0000139964 GCATGTCTGAACAACTGGGTT pLKO.1 713 CDS 100% 2.640 1.848 N ABRAXAS1 n/a
9 TRCN0000143445 GCCTTAGACTTAGATGACAGA pLKO.1 1240 CDS 100% 2.640 1.848 N ABRAXAS1 n/a
10 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1722 3UTR 100% 4.950 2.475 Y ERN2 n/a
11 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1722 3UTR 100% 4.950 2.475 Y P3H4 n/a
12 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1722 3UTR 100% 4.950 2.475 Y P3H4 n/a
13 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1724 3UTR 100% 4.950 2.475 Y CFLAR n/a
14 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1724 3UTR 100% 4.950 2.475 Y C19orf31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005263280.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12784 pDONR223 100% 83.3% 83.3% None 1_180del n/a
2 ccsbBroad304_12784 pLX_304 0% 83.3% 83.3% V5 1_180del n/a
3 TRCN0000478871 ATGGCTGCTTTCCGGAGTGTTTTA pLX_317 39.7% 83.3% 83.3% V5 1_180del n/a
Download CSV