Transcript: Human XM_005264200.5

PREDICTED: Homo sapiens sprouty related EVH1 domain containing 2 (SPRED2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPRED2 (200734)
Length:
1995
CDS:
355..1101

Additional Resources:

NCBI RefSeq record:
XM_005264200.5
NBCI Gene record:
SPRED2 (200734)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264200.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370470 GAGCAACCTACTCGGACAATC pLKO_005 832 CDS 100% 10.800 15.120 N SPRED2 n/a
2 TRCN0000056828 GCAATCGAAGACCTTATAGAA pLKO.1 706 CDS 100% 5.625 7.875 N SPRED2 n/a
3 TRCN0000056830 CAGCTATATTGTGCGTGTCAA pLKO.1 384 CDS 100% 4.950 6.930 N SPRED2 n/a
4 TRCN0000365424 ATCACTGGAAGGTCGATAATA pLKO_005 620 CDS 100% 15.000 10.500 N SPRED2 n/a
5 TRCN0000365356 CTGTGAGCACCGGAGGATTTA pLKO_005 867 CDS 100% 13.200 9.240 N SPRED2 n/a
6 TRCN0000056832 CAACAGCTACAGACAGTTCTT pLKO.1 791 CDS 100% 4.950 3.465 N SPRED2 n/a
7 TRCN0000056829 AGAAAGACAAACTGGTGGTAT pLKO.1 545 CDS 100% 4.950 2.970 N SPRED2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264200.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05192 pDONR223 100% 54.2% 45.9% None (many diffs) n/a
2 ccsbBroad304_05192 pLX_304 0% 54.2% 45.9% V5 (many diffs) n/a
3 TRCN0000476321 CTGGATCGCTCCCCTCCTTGCGCC pLX_317 30.4% 54.2% 45.9% V5 (many diffs) n/a
Download CSV