Transcript: Human XM_005264280.2

PREDICTED: Homo sapiens hexokinase 2 (HK2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HK2 (3099)
Length:
5685
CDS:
456..3272

Additional Resources:

NCBI RefSeq record:
XM_005264280.2
NBCI Gene record:
HK2 (3099)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264280.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232928 CTTAGGGCAGTCAGTAGTATT pLKO_005 4513 3UTR 100% 13.200 18.480 N HK2 n/a
2 TRCN0000037670 CCGTAACATTCTCATCGATTT pLKO.1 2780 CDS 100% 10.800 15.120 N HK2 n/a
3 TRCN0000232926 CCGTAACATTCTCATCGATTT pLKO_005 2780 CDS 100% 10.800 15.120 N HK2 n/a
4 TRCN0000232925 GGGACTTTGATATCGACATTG pLKO_005 1045 CDS 100% 10.800 15.120 N HK2 n/a
5 TRCN0000196724 GACTTTGATATCGACATTGTG pLKO.1 1047 CDS 100% 4.950 6.930 N HK2 n/a
6 TRCN0000195171 CTTCATGGATAAGCTACAAAT pLKO.1 863 CDS 100% 13.200 9.240 N HK2 n/a
7 TRCN0000232927 TGACGACAGCATCATTGTTAA pLKO_005 2957 CDS 100% 13.200 9.240 N HK2 n/a
8 TRCN0000195582 CCAAAGACATCTCAGACATTG pLKO.1 1462 CDS 100% 10.800 7.560 N HK2 n/a
9 TRCN0000232924 GGGTGAAAGTAACGGACAATG pLKO_005 736 CDS 100% 10.800 7.560 N HK2 n/a
10 TRCN0000037671 ACTGAGTTTGACCAGGAGATT pLKO.1 1278 CDS 100% 4.950 3.465 N HK2 n/a
11 TRCN0000037672 CACTGTGAAGTTGGCCTCATT pLKO.1 2529 CDS 100% 4.950 3.465 N HK2 n/a
12 TRCN0000199344 CGAGCCATCCTGCAACACTTA pLKO.1 2919 CDS 100% 4.950 3.465 N HK2 n/a
13 TRCN0000197099 GCAGAAGGTTGACCAGTATCT pLKO.1 512 CDS 100% 4.950 3.465 N HK2 n/a
14 TRCN0000037669 GCCTGGCTAACTTCATGGATA pLKO.1 853 CDS 100% 4.950 3.465 N HK2 n/a
15 TRCN0000037673 GCTACAAATCAAAGACAAGAA pLKO.1 875 CDS 100% 4.950 3.465 N HK2 n/a
16 TRCN0000195340 CCAGAAGACATTAGAGCATCT pLKO.1 1865 CDS 100% 4.050 2.835 N HK2 n/a
17 TRCN0000199240 CCCAGCTGTTTGACCACATTG pLKO.1 826 CDS 100% 10.800 6.480 N HK2 n/a
18 TRCN0000196260 GCTTGAAGATTAGGTACTATC pLKO.1 5330 3UTR 100% 10.800 6.480 N HK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264280.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14667 pDONR223 0% 97.7% 97.7% None 1838_1900del;2361A>G n/a
2 ccsbBroad304_14667 pLX_304 0% 97.7% 97.7% V5 1838_1900del;2361A>G n/a
3 TRCN0000467008 CCTAATCTACTCTTGTATTGAAAG pLX_317 13.4% 97.7% 97.7% V5 1838_1900del;2361A>G n/a
4 TRCN0000488991 TATGTTCAGGTTCGCAGAACGATA pLX_317 11.8% 97.7% 97.7% V5 (not translated due to prior stop codon) 1838_1900del;2361A>G n/a
5 ccsbBroadEn_14666 pDONR223 54.9% 97.2% 97% None (many diffs) n/a
6 ccsbBroad304_14666 pLX_304 0% 97.2% 97% V5 (many diffs) n/a
7 TRCN0000480635 ATATTCCAATAGCCCATCCGTAAT pLX_317 16% 97.2% 97% V5 (many diffs) n/a
Download CSV