Transcript: Human XM_005264875.4

PREDICTED: Homo sapiens TAM41 mitochondrial translocator assembly and maintenance homolog (TAMM41), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TAMM41 (132001)
Length:
898
CDS:
246..815

Additional Resources:

NCBI RefSeq record:
XM_005264875.4
NBCI Gene record:
TAMM41 (132001)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264875.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431089 GTAATGGTAGGCTTATCAAAT pLKO_005 553 CDS 100% 13.200 18.480 N TAMM41 n/a
2 TRCN0000420990 AGATCAGCCCTCGATAGAAAT pLKO_005 693 CDS 100% 13.200 10.560 N TAMM41 n/a
3 TRCN0000148712 CACGTCCATCCAGAATAACTA pLKO.1 497 CDS 100% 5.625 4.500 N TAMM41 n/a
4 TRCN0000130721 GAAGAATGCTATGCTGGACTT pLKO.1 377 CDS 100% 4.050 3.240 N TAMM41 n/a
5 TRCN0000429925 GCGCTGGAGTTTACTACAATT pLKO_005 520 CDS 100% 13.200 9.240 N TAMM41 n/a
6 TRCN0000148040 GAAGACCTCTTCATAGAGATT pLKO.1 768 CDS 100% 4.950 3.465 N TAMM41 n/a
7 TRCN0000148145 GACTTTGTGTTCACAGTAGAT pLKO.1 393 CDS 100% 4.950 3.465 N TAMM41 n/a
8 TRCN0000148146 GCATTCAAAGAACCTGAAGAA pLKO.1 428 CDS 100% 4.950 3.465 N TAMM41 n/a
9 TRCN0000432496 TGAGTCTGGCTTTCGTCTACG pLKO_005 316 CDS 100% 4.050 2.835 N TAMM41 n/a
10 TRCN0000430266 TTATCTCAGTGAACGAGGATG pLKO_005 664 CDS 100% 4.050 2.835 N TAMM41 n/a
11 TRCN0000424134 TCCTCAACTGGAATAACTTAT pLKO_005 610 CDS 100% 13.200 7.920 N TAMM41 n/a
12 TRCN0000148635 CTGGACTTTGTGTTCACAGTA pLKO.1 390 CDS 100% 4.950 2.970 N TAMM41 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264875.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14380 pDONR223 100% 59.4% 8.2% None (many diffs) n/a
2 ccsbBroad304_14380 pLX_304 0% 59.4% 8.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000471103 AAAAACCCTATCCACGGGTGAATC pLX_317 29.7% 59.4% 8.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV