Transcript: Human XM_005265072.3

PREDICTED: Homo sapiens golgin A4 (GOLGA4), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GOLGA4 (2803)
Length:
7795
CDS:
281..7090

Additional Resources:

NCBI RefSeq record:
XM_005265072.3
NBCI Gene record:
GOLGA4 (2803)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005265072.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061989 CGCTTAATAAAGCTAGAACAT pLKO.1 5723 CDS 100% 4.950 6.930 N GOLGA4 n/a
2 TRCN0000310561 CGCTTAATAAAGCTAGAACAT pLKO_005 5723 CDS 100% 4.950 6.930 N GOLGA4 n/a
3 TRCN0000061992 CGAATTTGAGTATTTGCGAAA pLKO.1 6916 CDS 100% 4.050 5.670 N GOLGA4 n/a
4 TRCN0000293795 CGGCTTACCTTTCCTATTTAT pLKO_005 7439 3UTR 100% 15.000 12.000 N GOLGA4 n/a
5 TRCN0000293845 AGGAACAATGTACACTATTAA pLKO_005 1314 CDS 100% 15.000 10.500 N GOLGA4 n/a
6 TRCN0000061991 CGTGATGCAAAGAACTTAATT pLKO.1 1442 CDS 100% 15.000 10.500 N GOLGA4 n/a
7 TRCN0000286364 CGTGATGCAAAGAACTTAATT pLKO_005 1442 CDS 100% 15.000 10.500 N GOLGA4 n/a
8 TRCN0000293847 GCGTCAAGAGAACCTACTTAA pLKO_005 1264 CDS 100% 13.200 9.240 N GOLGA4 n/a
9 TRCN0000061988 GCCCACATAGAAGAAATGAAT pLKO.1 2393 CDS 100% 5.625 3.938 N GOLGA4 n/a
10 TRCN0000286363 GCCCACATAGAAGAAATGAAT pLKO_005 2393 CDS 100% 5.625 3.938 N GOLGA4 n/a
11 TRCN0000061990 GCTAGATATTTGCTGTAAGAA pLKO.1 4045 CDS 100% 5.625 3.938 N GOLGA4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005265072.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10854 pDONR223 100% 7.2% 7% None (many diffs) n/a
2 ccsbBroad304_10854 pLX_304 0% 7.2% 7% V5 (many diffs) n/a
3 TRCN0000468519 CATCCACAGGTATCCAATTATTTT pLX_317 68.9% 7.2% 7% V5 (many diffs) n/a
Download CSV