Transcript: Human XM_005265388.4

PREDICTED: Homo sapiens kinesin family member 9 (KIF9), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIF9 (64147)
Length:
2763
CDS:
35..2506

Additional Resources:

NCBI RefSeq record:
XM_005265388.4
NBCI Gene record:
KIF9 (64147)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005265388.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428774 GTAGTGAGATCAACCGAATTT pLKO_005 1899 CDS 100% 13.200 18.480 N KIF9 n/a
2 TRCN0000116693 CCCAGTTAGAAGAAACGCTAT pLKO.1 1098 CDS 100% 4.050 5.670 N KIF9 n/a
3 TRCN0000116692 CGCCAGTACCTTAAAGGACAA pLKO.1 2515 3UTR 100% 4.050 5.670 N KIF9 n/a
4 TRCN0000116694 GCCCAGTTAGAAGAAACGCTA pLKO.1 1097 CDS 100% 2.640 3.696 N KIF9 n/a
5 TRCN0000438160 CAGGCCCTCGATGGCTATAAT pLKO_005 371 CDS 100% 15.000 10.500 N KIF9 n/a
6 TRCN0000413666 GATAGAGCAGAAGCATAATTA pLKO_005 2443 CDS 100% 15.000 10.500 N KIF9 n/a
7 TRCN0000116695 CCATCTACTTAGAGGCCCATT pLKO.1 795 CDS 100% 4.050 2.835 N KIF9 n/a
8 TRCN0000116696 GCGTGTTTCCTACTTGGAAAT pLKO.1 544 CDS 100% 1.080 0.756 N KIF9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005265388.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08840 pDONR223 100% 95.9% 95.8% None 1_99del;2011C>T n/a
2 ccsbBroad304_08840 pLX_304 0% 95.9% 95.8% V5 1_99del;2011C>T n/a
3 TRCN0000470800 CATAACCGTGCCTCCACCAATGCG pLX_317 21.5% 95.9% 95.8% V5 1_99del;2011C>T n/a
4 ccsbBroadEn_12451 pDONR223 100% 10.8% 10.5% None (many diffs) n/a
5 ccsbBroad304_12451 pLX_304 0% 10.8% 10.5% V5 (many diffs) n/a
6 TRCN0000476671 TTTCGACACCTCCACATTCTTAGT pLX_317 100% 10.8% 10.5% V5 (many diffs) n/a
Download CSV