Transcript: Human XM_005265731.3

PREDICTED: Homo sapiens defective in cullin neddylation 1 domain containing 4 (DCUN1D4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DCUN1D4 (23142)
Length:
3279
CDS:
2..907

Additional Resources:

NCBI RefSeq record:
XM_005265731.3
NBCI Gene record:
DCUN1D4 (23142)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005265731.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147759 GCCACAAATCATTTCTACCAT pLKO.1 1515 3UTR 100% 3.000 2.400 N DCUN1D4 n/a
2 TRCN0000128996 GCTGTTTGTATCAAAGCGCAT pLKO.1 973 3UTR 100% 2.160 1.728 N DCUN1D4 n/a
3 TRCN0000129753 CTTCTCTCCAATGTGATACAA pLKO.1 630 CDS 100% 5.625 3.938 N DCUN1D4 n/a
4 TRCN0000128648 CTCAGCAACTATGATGAAGAT pLKO.1 824 CDS 100% 4.950 3.465 N DCUN1D4 n/a
5 TRCN0000149804 GCATTCTTCTAGCCAGTGATT pLKO.1 1702 3UTR 100% 4.950 3.465 N DCUN1D4 n/a
6 TRCN0000147247 GCCAGAATTAACCTTACTGTT pLKO.1 1357 3UTR 100% 4.950 3.465 N DCUN1D4 n/a
7 TRCN0000149004 GCTTGGAAATTGGATGCACAA pLKO.1 566 CDS 100% 4.050 2.835 N DCUN1D4 n/a
8 TRCN0000149752 GACATTGGTGTTGAACCAGAA pLKO.1 524 CDS 100% 4.050 2.430 N DCUN1D4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005265731.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11685 pDONR223 100% 65.4% 65.4% None 1_312del n/a
2 ccsbBroad304_11685 pLX_304 0% 65.4% 65.4% V5 1_312del n/a
3 TRCN0000480771 GCCTGCGAACGCAGCACTCCAGTT pLX_317 55.4% 65.4% 65.4% V5 1_312del n/a
Download CSV