Transcript: Human XM_005266059.4

PREDICTED: Homo sapiens peptidase, mitochondrial processing alpha subunit (PMPCA), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PMPCA (23203)
Length:
2522
CDS:
12..1703

Additional Resources:

NCBI RefSeq record:
XM_005266059.4
NBCI Gene record:
PMPCA (23203)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005266059.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051474 GCGAAATACCTTAGTGGAATT pLKO.1 315 CDS 100% 0.000 0.000 N PMPCA n/a
2 TRCN0000290302 GCGAAATACCTTAGTGGAATT pLKO_005 315 CDS 100% 0.000 0.000 N PMPCA n/a
3 TRCN0000051475 GCTGACATCAATGCTCATGAT pLKO.1 1301 CDS 100% 4.950 3.465 N PMPCA n/a
4 TRCN0000290372 GCTGACATCAATGCTCATGAT pLKO_005 1301 CDS 100% 4.950 3.465 N PMPCA n/a
5 TRCN0000051476 GCTACAGTTGATGGACAGGAA pLKO.1 180 CDS 100% 2.640 1.848 N PMPCA n/a
6 TRCN0000290373 GCTACAGTTGATGGACAGGAA pLKO_005 180 CDS 100% 2.640 1.848 N PMPCA n/a
7 TRCN0000051473 GCTCGATTTGACAGCAAAGAT pLKO.1 372 CDS 100% 5.625 3.375 N PMPCA n/a
8 TRCN0000290304 GCTCGATTTGACAGCAAAGAT pLKO_005 372 CDS 100% 5.625 3.375 N PMPCA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005266059.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07853 pDONR223 100% 88% 83.7% None (many diffs) n/a
2 ccsbBroad304_07853 pLX_304 0% 88% 83.7% V5 (many diffs) n/a
3 TRCN0000477523 TTAAAATCGCCAGCACTACGCCTT pLX_317 22.7% 88% 83.7% V5 (many diffs) n/a
4 ccsbBroadEn_15008 pDONR223 54.9% 87.7% 1.9% None (many diffs) n/a
5 ccsbBroad304_15008 pLX_304 0% 87.7% 1.9% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000480244 CATGTGCGTCGTAGAGGGTCGTAC pLX_317 22.7% 87.7% 1.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV