Transcript: Human XM_005266881.2

PREDICTED: Homo sapiens fyn related Src family tyrosine kinase (FRK), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FRK (2444)
Length:
3337
CDS:
437..1954

Additional Resources:

NCBI RefSeq record:
XM_005266881.2
NBCI Gene record:
FRK (2444)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146590 AGTTGCGGTCTATCTCCCAT pXPR_003 TGG 680 45% 5 0.5907 FRK FRK 76242
2 BRDN0001149083 GCAGTGAAAACATTAAAACC pXPR_003 AGG 794 52% 5 0.579 FRK FRK 76241
3 BRDN0001148904 CACTACACCAAGACAAGTGA pXPR_003 CGG 590 39% 4 -0.0383 FRK FRK 76243
4 BRDN0001144749 CTATATTCCTTCTAACTACG pXPR_003 TGG 310 20% 2 -0.1821 FRK FRK 76240
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005266881.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356027 CCTCGTTGGTGAACATAATAT pLKO_005 1516 CDS 100% 15.000 21.000 N FRK n/a
2 TRCN0000219688 AGCAACTACAAGGCTATATTC pLKO.1 717 CDS 100% 13.200 18.480 N FRK n/a
3 TRCN0000231472 AGCAACTACAAGGCTATATTC pLKO_005 717 CDS 100% 13.200 18.480 N FRK n/a
4 TRCN0000231475 CCCGAAGCCATTCGTAGTAAT pLKO_005 1640 CDS 100% 13.200 18.480 N FRK n/a
5 TRCN0000195487 CCTAAGGAACGACCTACATTT pLKO.1 1856 CDS 100% 13.200 18.480 N FRK n/a
6 TRCN0000195605 CCAGGTTCAATGGATCCAAAT pLKO.1 1232 CDS 100% 10.800 15.120 N FRK n/a
7 TRCN0000010095 GCTCCATTTGATTTGTCGTAT pLKO.1 1079 CDS 100% 4.950 6.930 N FRK n/a
8 TRCN0000194652 CCTGACATATTCAAGTGATAG pLKO.1 2052 3UTR 100% 10.800 8.640 N FRK n/a
9 TRCN0000010097 CGAAATAAAGCTGCCGGTGAA pLKO.1 1609 CDS 100% 4.050 3.240 N FRK n/a
10 TRCN0000355976 AGGACAGTCAAGGTGATATAT pLKO_005 2137 3UTR 100% 15.000 10.500 N FRK n/a
11 TRCN0000231473 CCATTTGATTTGTCGTATAAA pLKO_005 1082 CDS 100% 15.000 10.500 N FRK n/a
12 TRCN0000231474 TGAATCTAGACACGAAATAAA pLKO_005 1597 CDS 100% 15.000 10.500 N FRK n/a
13 TRCN0000378239 AGCACACTAAACCAAGTTATT pLKO_005 2184 3UTR 100% 13.200 9.240 N FRK n/a
14 TRCN0000219689 TGATTGTACTTGGAGTAATTG pLKO.1 2488 3UTR 100% 13.200 9.240 N FRK n/a
15 TRCN0000231476 TGATTGTACTTGGAGTAATTG pLKO_005 2488 3UTR 100% 13.200 9.240 N FRK n/a
16 TRCN0000010098 GCCGTGGTTCTTTGGAGCAAT pLKO.1 778 CDS 100% 4.950 3.465 N FRK n/a
17 TRCN0000010096 CAGTTTGGCGAAGTATGGGAA pLKO.1 1166 CDS 100% 2.640 1.848 N FRK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005266881.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00590 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00590 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467336 AGGATTCAGGGTCCTTTCTATAGG pLX_317 29.1% 100% 100% V5 n/a
4 ccsbBroadEn_14647 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_14647 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000481127 AATGGACTAATAGTCCTTCCAAAG pLX_317 30.8% 100% 100% V5 n/a
7 TRCN0000492174 ATGCAGAACATGCAAACTCACTCT pLX_317 27.7% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV