Transcript: Human XM_005267747.4

PREDICTED: Homo sapiens solute carrier family 22 member 17 (SLC22A17), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC22A17 (51310)
Length:
4541
CDS:
2581..4197

Additional Resources:

NCBI RefSeq record:
XM_005267747.4
NBCI Gene record:
SLC22A17 (51310)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005267747.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038228 CCTCCTCAACTACCGCAACAT pLKO.1 3471 CDS 100% 4.950 6.930 N SLC22A17 n/a
2 TRCN0000038225 CCTCTGCATTCTCAGCATTAT pLKO.1 4032 CDS 100% 13.200 9.240 N SLC22A17 n/a
3 TRCN0000038226 GCGATTCCTACAGCGAATGAT pLKO.1 3219 CDS 100% 5.625 3.938 N SLC22A17 n/a
4 TRCN0000038227 CTGATAGTGAAGCGGCAGATT pLKO.1 3307 CDS 100% 4.950 3.465 N SLC22A17 n/a
5 TRCN0000038224 CCTGCTGCTTTGCATTCACTT pLKO.1 4358 3UTR 100% 4.950 2.970 N SLC22A17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005267747.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08274 pDONR223 100% 99.9% 100% None 15C>T n/a
2 ccsbBroad304_08274 pLX_304 0% 99.9% 100% V5 15C>T n/a
3 TRCN0000473865 GCCAGAACTCAAGTATCTTCGGCA pLX_317 29.1% 99.9% 100% V5 15C>T n/a
Download CSV