Transcript: Human XM_005268380.2

PREDICTED: Homo sapiens SH3 domain containing ring finger 2 (SH3RF2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SH3RF2 (153769)
Length:
5789
CDS:
235..2442

Additional Resources:

NCBI RefSeq record:
XM_005268380.2
NBCI Gene record:
SH3RF2 (153769)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005268380.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148008 GAAGGCAAGTTAGGAGATAAA pLKO.1 928 CDS 100% 13.200 18.480 N SH3RF2 n/a
2 TRCN0000430997 CTACACCACATGGACGTTATC pLKO_005 1596 CDS 100% 10.800 15.120 N SH3RF2 n/a
3 TRCN0000428424 GACCTTCCTCAAGGACGATAT pLKO_005 870 CDS 100% 10.800 8.640 N SH3RF2 n/a
4 TRCN0000180280 CGGAGACAGCTTGATGAGAAT pLKO.1 697 CDS 100% 4.950 3.960 N SH3RF2 n/a
5 TRCN0000183761 CTTCCCAAACAATTACGTCAT pLKO.1 1524 CDS 100% 4.050 3.240 N SH3RF2 n/a
6 TRCN0000147973 GTTAGGAGATAAAGTAGGCAT pLKO.1 936 CDS 100% 2.640 1.848 N SH3RF2 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5071 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5071 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005268380.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09702 pDONR223 100% 99% 98.6% None (many diffs) n/a
2 ccsbBroadEn_13294 pDONR223 100% 29.8% 29.6% None 1_1545del;1792T>C;2147G>C n/a
3 ccsbBroad304_13294 pLX_304 0% 29.8% 29.6% V5 1_1545del;1792T>C;2147G>C n/a
4 TRCN0000465659 GTACCCTAGGTCAATGATCGGCAG pLX_317 31.6% 29.8% 29.6% V5 1_1545del;1792T>C;2147G>C n/a
Download CSV