Transcript: Human XM_005269133.2

PREDICTED: Homo sapiens nuclear receptor subfamily 2 group C member 1 (NR2C1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NR2C1 (7181)
Length:
3988
CDS:
244..2040

Additional Resources:

NCBI RefSeq record:
XM_005269133.2
NBCI Gene record:
NR2C1 (7181)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005269133.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244442 GATGAATGTAGCAACTATATT pLKO_005 1575 CDS 100% 15.000 12.000 N NR2C1 n/a
2 TRCN0000244443 GCATTGATGGATACGAATATG pLKO_005 1706 CDS 100% 13.200 10.560 N NR2C1 n/a
3 TRCN0000021648 GCCAATGTGGTTACATCATTA pLKO.1 1060 CDS 100% 13.200 10.560 N NR2C1 n/a
4 TRCN0000021646 CCATTGAAGTATCACGAGAAA pLKO.1 809 CDS 100% 4.950 3.960 N NR2C1 n/a
5 TRCN0000244444 GCAGGTGTCAACCAGTTATTT pLKO_005 472 CDS 100% 15.000 10.500 N NR2C1 n/a
6 TRCN0000244441 AGGACCTTCGTAGCCCATTAA pLKO_005 875 CDS 100% 13.200 9.240 N NR2C1 n/a
7 TRCN0000021645 CGAGGATCAAAGGATTGTATT pLKO.1 691 CDS 100% 13.200 9.240 N NR2C1 n/a
8 TRCN0000244445 GAATTGTGTTCTAGTCATATT pLKO_005 2374 3UTR 100% 13.200 9.240 N NR2C1 n/a
9 TRCN0000021647 CCTGCAGATTATAACTCTCAA pLKO.1 1999 CDS 100% 4.950 3.465 N NR2C1 n/a
10 TRCN0000021644 GCCAGCTTTAAGACTGATGAA pLKO.1 1890 CDS 100% 4.950 3.465 N NR2C1 n/a
11 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 2857 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005269133.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01709 pDONR223 100% 77.8% 77.5% None (many diffs) n/a
2 ccsbBroad304_01709 pLX_304 0% 77.8% 77.5% V5 (many diffs) n/a
3 TRCN0000466565 GTAGGGGTTCACCGAAATCTACAC pLX_317 29.3% 77.8% 77.5% V5 (many diffs) n/a
4 TRCN0000488735 TATACCCAAGGGAGTGTTTATAAA pLX_317 19% 77.8% 77.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV