Transcript: Human XM_005269525.5

PREDICTED: Homo sapiens sideroflexin 4 (SFXN4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SFXN4 (119559)
Length:
1355
CDS:
40..1026

Additional Resources:

NCBI RefSeq record:
XM_005269525.5
NBCI Gene record:
SFXN4 (119559)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005269525.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107047 CGAGGCAACTATTGTGCACAA pLKO.1 233 CDS 100% 4.050 5.670 N SFXN4 n/a
2 TRCN0000107049 AGCCGTTGCTTCTTCAACTTT pLKO.1 522 CDS 100% 5.625 3.938 N SFXN4 n/a
3 TRCN0000107045 AGGTTCGGTTTAGAGAACTTT pLKO.1 1081 3UTR 100% 5.625 3.938 N SFXN4 n/a
4 TRCN0000107046 GCAGCGTTCAACAGCATCAAT pLKO.1 448 CDS 100% 5.625 3.938 N SFXN4 n/a
5 TRCN0000107048 GCATCCAGAATAGTGCTGTTT pLKO.1 763 CDS 100% 4.950 3.465 N SFXN4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005269525.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04738 pDONR223 100% 97.2% 97.3% None 252_253ins27;327A>G n/a
2 ccsbBroad304_04738 pLX_304 0% 97.2% 97.3% V5 252_253ins27;327A>G n/a
3 TRCN0000471762 GACCGCCTGATACTGACCGACGAC pLX_317 46.2% 97.2% 97.3% V5 252_253ins27;327A>G n/a
Download CSV