Transcript: Human XM_005270172.3

PREDICTED: Homo sapiens cilia and flagella associated protein 43 (CFAP43), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CFAP43 (80217)
Length:
5282
CDS:
118..5031

Additional Resources:

NCBI RefSeq record:
XM_005270172.3
NBCI Gene record:
CFAP43 (80217)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005270172.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263901 CGGCCGAAAGATGATCTATAT pLKO_005 850 CDS 100% 13.200 18.480 N CFAP43 n/a
2 TRCN0000263899 GTGTATCCGAGACGTTTATAC pLKO_005 2106 CDS 100% 13.200 18.480 N CFAP43 n/a
3 TRCN0000263900 TGGTAGTCTGAGTACTGATTT pLKO_005 3057 CDS 100% 13.200 18.480 N CFAP43 n/a
4 TRCN0000167473 GCTTGTGTAAGCAAGATTTAT pLKO.1 1381 CDS 100% 15.000 12.000 N CFAP43 n/a
5 TRCN0000263898 TATGAGGCTCTGATTAGTATT pLKO_005 4648 CDS 100% 13.200 9.240 N CFAP43 n/a
6 TRCN0000167763 GCAAAGATGATAAAGGATGTA pLKO.1 2701 CDS 100% 4.950 3.465 N CFAP43 n/a
7 TRCN0000172640 GCCACAAGTTTCCACAACCTT pLKO.1 1800 CDS 100% 3.000 2.100 N CFAP43 n/a
8 TRCN0000263897 ACAAGGCCAAATCAATCATTT pLKO_005 5050 3UTR 100% 13.200 7.920 N CFAP43 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005270172.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14282 pDONR223 100% 57.2% 3.9% None (many diffs) n/a
2 ccsbBroad304_14282 pLX_304 0% 57.2% 3.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000477225 ATACCCGATGGGCTAGCAATCACC pLX_317 10.7% 57.2% 3.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV