Transcript: Human XM_005272200.3

PREDICTED: Homo sapiens argininosuccinate synthase 1 (ASS1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ASS1 (445)
Length:
1591
CDS:
100..1338

Additional Resources:

NCBI RefSeq record:
XM_005272200.3
NBCI Gene record:
ASS1 (445)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005272200.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440576 CCCAAGTACAGGCGCTAATTG pLKO_005 1384 3UTR 100% 13.200 18.480 N ASS1 n/a
2 TRCN0000045554 GCCTGAATTCTACAACCGGTT pLKO.1 540 CDS 100% 0.000 0.000 N ASS1 n/a
3 TRCN0000436210 ATGAACGTGCAGGGTGATTAT pLKO_005 1228 CDS 100% 13.200 9.240 N ASS1 n/a
4 TRCN0000437923 GAGCAAGGTCACTGCCAAATA pLKO_005 1317 CDS 100% 13.200 9.240 N Ass1 n/a
5 TRCN0000443685 ACGCAAAGCAACACGGGATTC pLKO_005 587 CDS 100% 6.000 4.200 N ASS1 n/a
6 TRCN0000045556 CTCAGGCTGAAGGAATATCAT pLKO.1 1288 CDS 100% 5.625 3.938 N ASS1 n/a
7 TRCN0000045553 CCATCCTTTACCATGCTCATT pLKO.1 962 CDS 100% 4.950 3.465 N ASS1 n/a
8 TRCN0000075722 TGGCTGAAGGAACAAGGCTAT pLKO.1 166 CDS 100% 4.050 2.835 N Ass1 n/a
9 TRCN0000045557 CAGAAGGAAGACTTCGAGGAA pLKO.1 217 CDS 100% 2.640 1.848 N ASS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005272200.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00116 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00116 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467990 CCTCTCAAATCGAGATCTGATGTC pLX_317 27.8% 100% 100% V5 n/a
4 ccsbBroadEn_05861 pDONR223 100% 99.9% 100% None 876T>C n/a
5 ccsbBroad304_05861 pLX_304 0% 99.9% 100% V5 876T>C n/a
6 TRCN0000465353 ACTAATAACATTGGTCCGTTAACG pLX_317 19.2% 99.9% 100% V5 876T>C n/a
Download CSV