Transcript: Human XM_005273212.4

PREDICTED: Homo sapiens signal induced proliferation associated 1 like 2 (SIPA1L2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SIPA1L2 (57568)
Length:
6744
CDS:
414..5582

Additional Resources:

NCBI RefSeq record:
XM_005273212.4
NBCI Gene record:
SIPA1L2 (57568)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005273212.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243999 CACCCTTATTTAAGCTTATTT pLKO_005 6476 3UTR 100% 15.000 21.000 N SIPA1L2 n/a
2 TRCN0000243997 CCGCATCTCAGGATTAGATTA pLKO_005 1181 CDS 100% 13.200 18.480 N SIPA1L2 n/a
3 TRCN0000257154 CGACGAGCCAGCCAAGTTATA pLKO_005 4334 CDS 100% 13.200 18.480 N SIPA1L2 n/a
4 TRCN0000243996 GGCCTATTATTACCGCAAATT pLKO_005 1862 CDS 100% 13.200 18.480 N SIPA1L2 n/a
5 TRCN0000148082 GCTTTGATGAAGTGTCTTGTA pLKO.1 6450 3UTR 100% 4.950 6.930 N SIPA1L2 n/a
6 TRCN0000243998 CTGAATGTCCCGGGATGTATA pLKO_005 4657 CDS 100% 13.200 10.560 N SIPA1L2 n/a
7 TRCN0000148058 GCAGTTACCTTAGAGACTTAT pLKO.1 6181 3UTR 100% 13.200 9.240 N SIPA1L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005273212.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12366 pDONR223 100% 30.8% 30.8% None (many diffs) n/a
2 ccsbBroad304_12366 pLX_304 0% 30.8% 30.8% V5 (many diffs) n/a
3 TRCN0000466707 CGTGTCACTGTCCATGGGCTACTC pLX_317 26.2% 30.8% 30.8% V5 (many diffs) n/a
Download CSV