Transcript: Human XM_005274716.3

PREDICTED: Homo sapiens family with sequence similarity 3 member A (FAM3A), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM3A (60343)
Length:
1758
CDS:
377..1111

Additional Resources:

NCBI RefSeq record:
XM_005274716.3
NBCI Gene record:
FAM3A (60343)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005274716.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156417 CGGGCTAAACATGTTTCCAGT pLKO.1 1535 3UTR 100% 2.640 3.696 N FAM3A n/a
2 TRCN0000350933 CGGGCTAAACATGTTTCCAGT pLKO_005 1535 3UTR 100% 2.640 3.696 N FAM3A n/a
3 TRCN0000155900 CAGTAAGCACAGCAACAAGTA pLKO.1 1027 CDS 100% 4.950 3.465 N FAM3A n/a
4 TRCN0000338799 CAGTAAGCACAGCAACAAGTA pLKO_005 1027 CDS 100% 4.950 3.465 N FAM3A n/a
5 TRCN0000155204 GAACAGTAAGCACAGCAACAA pLKO.1 1024 CDS 100% 4.950 3.465 N FAM3A n/a
6 TRCN0000157587 GCAGCACGTGAAGAACAGTAA pLKO.1 1012 CDS 100% 4.950 3.465 N FAM3A n/a
7 TRCN0000156657 GCCACCAAGATGAATGAAGAG pLKO.1 881 CDS 100% 4.050 2.835 N FAM3A n/a
8 TRCN0000157661 GCACGTGAAGAACAGTAAGCA pLKO.1 1015 CDS 100% 3.000 2.100 N FAM3A n/a
9 TRCN0000338858 GCACGTGAAGAACAGTAAGCA pLKO_005 1015 CDS 100% 3.000 2.100 N FAM3A n/a
10 TRCN0000155950 CCAAGATGAATGAAGAGACCA pLKO.1 885 CDS 100% 2.640 1.848 N FAM3A n/a
11 TRCN0000155047 GAAGAACAGTAAGCACAGCAA pLKO.1 1021 CDS 100% 2.640 1.848 N FAM3A n/a
12 TRCN0000155561 CTGTTGAAGTTTATTCGGCCA pLKO.1 815 CDS 100% 0.540 0.378 N FAM3A n/a
13 TRCN0000157995 CCAGCCACCAAGATGAATGAA pLKO.1 878 CDS 100% 5.625 3.375 N FAM3A n/a
14 TRCN0000156617 GATTCCTTCCAGTGAGCCAAA pLKO.1 1558 3UTR 100% 4.050 2.430 N FAM3A n/a
15 TRCN0000338860 GATTCCTTCCAGTGAGCCAAA pLKO_005 1558 3UTR 100% 4.050 2.430 N FAM3A n/a
16 TRCN0000379219 TGAACATCGCCCTGGTGAATG pLKO_005 732 CDS 100% 10.800 6.480 N Fam3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005274716.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03882 pDONR223 100% 80.4% 80.4% None 0_1ins56;72_169del n/a
2 ccsbBroad304_03882 pLX_304 0% 80.4% 80.4% V5 0_1ins56;72_169del n/a
3 TRCN0000471077 GCAGGATCGCGCATTTGTCGATGC pLX_317 63.9% 80.4% 80.4% V5 0_1ins56;72_169del n/a
4 ccsbBroadEn_15957 pDONR223 0% 19.5% 6.8% None 0_1ins56;155_732del n/a
5 ccsbBroad304_15957 pLX_304 0% 19.5% 6.8% V5 0_1ins56;155_732del n/a
6 TRCN0000473845 GCCGGTTTATTAATATTCTCTACG pLX_317 100% 19.5% 6.8% V5 0_1ins56;155_732del n/a
Download CSV