Transcript: Mouse XM_006495655.3

PREDICTED: Mus musculus cAMP responsive element binding protein 1 (Creb1), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Creb1 (12912)
Length:
6131
CDS:
204..539

Additional Resources:

NCBI RefSeq record:
XM_006495655.3
NBCI Gene record:
Creb1 (12912)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495655.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096629 GCCTGAAAGCAACTACAGAAT pLKO.1 654 3UTR 100% 4.950 3.960 N Creb1 n/a
2 TRCN0000301658 GCCTGAAAGCAACTACAGAAT pLKO_005 654 3UTR 100% 4.950 3.960 N Creb1 n/a
3 TRCN0000356046 GCCTGAAAGCAACTACAGAAT pLKO_005 654 3UTR 100% 4.950 3.960 N CREB1 n/a
4 TRCN0000096632 AGCAAGAGAATGTCGTAGAAA pLKO.1 401 CDS 100% 5.625 3.938 N Creb1 n/a
5 TRCN0000007310 CGTCTAATGAAGAACAGGGAA pLKO.1 378 CDS 100% 2.640 1.848 N CREB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495655.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00360 pDONR223 100% 28.5% 29% None (many diffs) n/a
2 ccsbBroad304_00360 pLX_304 26.2% 28.5% 29% V5 (many diffs) n/a
3 TRCN0000475150 GGTGTGTATCCTCGACAATTCGGG pLX_317 58.1% 28.5% 29% V5 (many diffs) n/a
Download CSV