Transcript: Mouse XM_006495966.3

PREDICTED: Mus musculus IKAROS family zinc finger 2 (Ikzf2), transcript variant X12, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ikzf2 (22779)
Length:
9349
CDS:
326..1906

Additional Resources:

NCBI RefSeq record:
XM_006495966.3
NBCI Gene record:
Ikzf2 (22779)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495966.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085571 CCTATCATGGACAACAATATT pLKO.1 1070 CDS 100% 15.000 21.000 N Ikzf2 n/a
2 TRCN0000428537 AGCCAGGACCGCTACGAATTT pLKO_005 1847 CDS 100% 13.200 18.480 N Ikzf2 n/a
3 TRCN0000085568 CGTCACTTTATCAGCATTCAA pLKO.1 2831 3UTR 100% 5.625 7.875 N Ikzf2 n/a
4 TRCN0000021932 GCTTCCGAATGGTAAACTGAA pLKO.1 643 CDS 100% 4.950 6.930 N IKZF2 n/a
5 TRCN0000419740 CCTTGTTAAGGCCTATCATAA pLKO_005 2167 3UTR 100% 13.200 10.560 N Ikzf2 n/a
6 TRCN0000422551 AGAGAAGCTCACGGCAAATAT pLKO_005 1123 CDS 100% 15.000 10.500 N Ikzf2 n/a
7 TRCN0000431622 ATGATAACTTGGCTTGTTTAT pLKO_005 2108 3UTR 100% 13.200 9.240 N Ikzf2 n/a
8 TRCN0000218361 CAACCTTCTGAGACACATAAA pLKO_005 784 CDS 100% 13.200 9.240 N IKZF2 n/a
9 TRCN0000230585 CAATGTGCTTATGGTACATAA pLKO_005 697 CDS 100% 13.200 9.240 N IKZF2 n/a
10 TRCN0000085569 CGATTCAGCTACCCAGATATT pLKO.1 1196 CDS 100% 13.200 9.240 N Ikzf2 n/a
11 TRCN0000230586 GATTCAGCTACCCAGATATTC pLKO_005 1197 CDS 100% 13.200 9.240 N IKZF2 n/a
12 TRCN0000428415 GCAACCTTCTGAGACACATAA pLKO_005 783 CDS 100% 13.200 9.240 N Ikzf2 n/a
13 TRCN0000425936 GGTAAACCTCACAAGTGTAAC pLKO_005 902 CDS 100% 10.800 7.560 N Ikzf2 n/a
14 TRCN0000021933 GCTTATTCTCAGGTCTATCAT pLKO.1 1385 CDS 100% 5.625 3.938 N IKZF2 n/a
15 TRCN0000021929 CCCAGTTATAAGCTCAGCTTA pLKO.1 1369 CDS 100% 4.950 3.465 N IKZF2 n/a
16 TRCN0000085572 CTCGATTCTACTGACTCAGAA pLKO.1 1538 CDS 100% 4.950 3.465 N Ikzf2 n/a
17 TRCN0000085570 GCCTTAAATCCCAAGAGGAAA pLKO.1 1598 CDS 100% 4.950 3.465 N Ikzf2 n/a
18 TRCN0000021931 GCAACATCTGTGGCTACAGAA pLKO.1 1827 CDS 100% 0.495 0.347 N IKZF2 n/a
19 TRCN0000021930 CCAATGTGCTTATGGTACATA pLKO.1 696 CDS 100% 5.625 3.375 N IKZF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495966.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02685 pDONR223 100% 90.8% 92.9% None (many diffs) n/a
2 ccsbBroad304_02685 pLX_304 0% 90.8% 92.9% V5 (many diffs) n/a
3 TRCN0000474532 ACTCTCGGCGATATCCCCTGCCTC pLX_317 36% 90.7% 67.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV