Transcript: Mouse XM_006496232.3

PREDICTED: Mus musculus family with sequence similarity 135, member A (Fam135a), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam135a (68187)
Length:
5562
CDS:
220..4752

Additional Resources:

NCBI RefSeq record:
XM_006496232.3
NBCI Gene record:
Fam135a (68187)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496232.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264934 GTAAGTAGTGACACGATTAAA pLKO_005 2473 CDS 100% 15.000 21.000 N Fam135a n/a
2 TRCN0000345671 TAAGTAGTGACACGATTAAAT pLKO_005 2474 CDS 100% 15.000 21.000 N Fam135a n/a
3 TRCN0000345746 ACTTTGAGGGTTCGCAGATTT pLKO_005 1252 CDS 100% 13.200 18.480 N Fam135a n/a
4 TRCN0000264932 CGATCCTTATTCAGACTATAT pLKO_005 5052 3UTR 100% 13.200 10.560 N Fam135a n/a
5 TRCN0000190316 CGGAACACAATCTGGCATCTA pLKO.1 2120 CDS 100% 4.950 3.960 N Fam135a n/a
6 TRCN0000345786 CACTACACCAGCCGCTAATAA pLKO_005 752 CDS 100% 15.000 10.500 N Fam135a n/a
7 TRCN0000283238 GACATTCGTTAGGCAATTTAA pLKO_005 4178 CDS 100% 15.000 10.500 N Fam135a n/a
8 TRCN0000264933 TGAATGCCTTGCAACTAATAA pLKO_005 611 CDS 100% 15.000 10.500 N Fam135a n/a
9 TRCN0000413297 TGAATGCCTTGCAACTAATAA pLKO_005 611 CDS 100% 15.000 10.500 N FAM135A n/a
10 TRCN0000345747 AGTGTAGTCTTTGGTATTAAC pLKO_005 856 CDS 100% 13.200 9.240 N Fam135a n/a
11 TRCN0000435565 CTCAATTCATTACCTATAATC pLKO_005 1435 CDS 100% 13.200 9.240 N FAM135A n/a
12 TRCN0000345745 GATCCTTATTCAGACTATATC pLKO_005 5053 3UTR 100% 13.200 9.240 N Fam135a n/a
13 TRCN0000216603 GATGCTAAGTTTATGACATAT pLKO.1 4826 3UTR 100% 13.200 9.240 N Fam135a n/a
14 TRCN0000136155 GCCCGCATTGAAATGTGTAAA pLKO.1 4501 CDS 100% 13.200 9.240 N FAM135A n/a
15 TRCN0000200857 GCCTAAATCTTTGTGCAAATT pLKO.1 2045 CDS 100% 13.200 9.240 N Fam135a n/a
16 TRCN0000201523 CCTCATTTGGATGCTCCCTTT pLKO.1 3055 CDS 100% 4.050 2.835 N Fam135a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496232.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08746 pDONR223 100% 74.1% 70.9% None (many diffs) n/a
2 ccsbBroad304_08746 pLX_304 0% 74.1% 70.9% V5 (many diffs) n/a
3 TRCN0000471886 TCACCTAATACCTTCTTGCACCTA pLX_317 10.3% 74.1% 70.9% V5 (many diffs) n/a
Download CSV