Transcript: Mouse XM_006496551.3

PREDICTED: Mus musculus solute carrier family 16 (monocarboxylic acid transporters), member 14 (Slc16a14), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc16a14 (71781)
Length:
3916
CDS:
588..2126

Additional Resources:

NCBI RefSeq record:
XM_006496551.3
NBCI Gene record:
Slc16a14 (71781)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496551.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079623 CCGGTGGTGTCACTTATGAAT pLKO.1 2204 3UTR 100% 5.625 7.875 N Slc16a14 n/a
2 TRCN0000079625 CCGTGTATTCAGATGATAGAT pLKO.1 2067 CDS 100% 5.625 7.875 N Slc16a14 n/a
3 TRCN0000079624 CGCATGTTTGTAGCCTTTATT pLKO.1 1533 CDS 100% 15.000 12.000 N Slc16a14 n/a
4 TRCN0000079627 CCCGAAATCGTCAGTTTGTAT pLKO.1 1605 CDS 100% 5.625 3.938 N Slc16a14 n/a
5 TRCN0000079626 GCCCGAAATCGTCAGTTTGTA pLKO.1 1604 CDS 100% 5.625 3.938 N Slc16a14 n/a
6 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 3894 3UTR 100% 2.640 1.320 Y BC028528 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496551.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05051 pDONR223 100% 81.9% 87.1% None (many diffs) n/a
2 ccsbBroad304_05051 pLX_304 0% 81.9% 87.1% V5 (many diffs) n/a
3 TRCN0000474831 ACTGATAGTACCAGCTTAGCAGTC pLX_317 27.8% 81.9% 87.1% V5 (many diffs) n/a
Download CSV