Transcript: Mouse XM_006496860.2

PREDICTED: Mus musculus ring finger and WD repeat domain 2 (Rfwd2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rfwd2 (26374)
Length:
12244
CDS:
735..2210

Additional Resources:

NCBI RefSeq record:
XM_006496860.2
NBCI Gene record:
Rfwd2 (26374)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496860.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041083 CCTTGGTATAACAGCACATTA pLKO.1 1053 CDS 100% 13.200 10.560 N Rfwd2 n/a
2 TRCN0000335746 CCTTGGTATAACAGCACATTA pLKO_005 1053 CDS 100% 13.200 10.560 N Rfwd2 n/a
3 TRCN0000041086 GCTGTATCAGTTGGAGTAGTT pLKO.1 1435 CDS 100% 4.950 3.960 N Rfwd2 n/a
4 TRCN0000363790 GCTGTATCAGTTGGAGTAGTT pLKO_005 1435 CDS 100% 4.950 3.960 N Rfwd2 n/a
5 TRCN0000235230 CTCAAACAGAAGCAAAGATTT pLKO_005 606 5UTR 100% 13.200 9.240 N EG667784 n/a
6 TRCN0000041084 GCAAGCCAGTTAGATGAATTT pLKO.1 1170 CDS 100% 13.200 9.240 N Rfwd2 n/a
7 TRCN0000335668 GCAAGCCAGTTAGATGAATTT pLKO_005 1170 CDS 100% 13.200 9.240 N Rfwd2 n/a
8 TRCN0000041085 GCAGTGTCTTATGCCAAGTTT pLKO.1 1815 CDS 100% 5.625 3.938 N Rfwd2 n/a
9 TRCN0000335747 GCAGTGTCTTATGCCAAGTTT pLKO_005 1815 CDS 100% 5.625 3.938 N Rfwd2 n/a
10 TRCN0000041087 CTCAACTCCTACGAGGACAAA pLKO.1 494 5UTR 100% 4.950 3.465 N Rfwd2 n/a
11 TRCN0000335666 CTCAACTCCTACGAGGACAAA pLKO_005 494 5UTR 100% 4.950 3.465 N Rfwd2 n/a
12 TRCN0000029723 GCTGGAGTTACAAAGAAGATT pLKO.1 1329 CDS 100% 5.625 3.375 N COP1 n/a
13 TRCN0000343445 GCTGGAGTTACAAAGAAGATT pLKO_005 1329 CDS 100% 5.625 3.375 N COP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496860.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03940 pDONR223 100% 62.6% 66.7% None (many diffs) n/a
2 ccsbBroad304_03940 pLX_304 0% 62.6% 66.7% V5 (many diffs) n/a
3 TRCN0000477822 GATACAACGGCCTAGATGTACCAA pLX_317 18.3% 62.6% 66.7% V5 (many diffs) n/a
Download CSV