Transcript: Mouse XM_006497038.3

PREDICTED: Mus musculus desumoylating isopeptidase 2 (Desi2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Desi2 (78825)
Length:
6857
CDS:
3191..3727

Additional Resources:

NCBI RefSeq record:
XM_006497038.3
NBCI Gene record:
Desi2 (78825)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497038.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329352 GGCGTCACACTAAACTATAAG pLKO_005 3708 CDS 100% 13.200 18.480 N Desi2 n/a
2 TRCN0000217580 GGGCGTCACACTAAACTATAA pLKO.1 3707 CDS 100% 13.200 18.480 N Desi2 n/a
3 TRCN0000197611 CCCTCTTTATAGGGAAAGTAA pLKO.1 5200 3UTR 100% 5.625 7.875 N Desi2 n/a
4 TRCN0000177031 GAATGAATACACCTCATCTAT pLKO.1 3193 CDS 100% 5.625 7.875 N Desi2 n/a
5 TRCN0000329349 GAATGAATACACCTCATCTAT pLKO_005 3193 CDS 100% 5.625 7.875 N Desi2 n/a
6 TRCN0000181242 CTTCAGTCTAGTGTCAGCCAA pLKO.1 3605 CDS 100% 2.640 3.696 N Desi2 n/a
7 TRCN0000215676 GAGCTAGGAGAAACATTTAAA pLKO.1 3326 CDS 100% 15.000 10.500 N Desi2 n/a
8 TRCN0000177395 GCAGCTTTAGATACGTGATTA pLKO.1 5074 3UTR 100% 13.200 9.240 N Desi2 n/a
9 TRCN0000329351 GCAGCTTTAGATACGTGATTA pLKO_005 5074 3UTR 100% 13.200 9.240 N Desi2 n/a
10 TRCN0000216107 CTTCAGCTTTATCAGAGATTC pLKO.1 3477 CDS 100% 10.800 7.560 N Desi2 n/a
11 TRCN0000177820 CCGCACCTCATAATAGAGATT pLKO.1 4778 3UTR 100% 4.950 3.465 N Desi2 n/a
12 TRCN0000329350 CCGCACCTCATAATAGAGATT pLKO_005 4778 3UTR 100% 4.950 3.465 N Desi2 n/a
13 TRCN0000198452 GAACTCCAGGATGAACTAGAA pLKO.1 3626 CDS 100% 4.950 3.465 N Desi2 n/a
14 TRCN0000329353 CATTCTGGAATTGAAGTATAT pLKO_005 3230 CDS 100% 13.200 7.920 N Desi2 n/a
15 TRCN0000172609 GAAAGAGATTCCTCGCTGGAT pLKO.1 3505 CDS 100% 2.640 1.584 N DESI2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497038.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03180 pDONR223 100% 82.8% 88.6% None (many diffs) n/a
2 ccsbBroad304_03180 pLX_304 0% 82.8% 88.6% V5 (many diffs) n/a
3 TRCN0000480850 TTGCAGGATTCGATTTTCGGGCAA pLX_317 65.9% 82.8% 88.6% V5 (many diffs) n/a
Download CSV