Transcript: Mouse XM_006497131.3

PREDICTED: Mus musculus protein tyrosine phosphatase, non-receptor type 14 (Ptpn14), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptpn14 (19250)
Length:
4041
CDS:
300..3869

Additional Resources:

NCBI RefSeq record:
XM_006497131.3
NBCI Gene record:
Ptpn14 (19250)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497131.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029017 GCGCTCTTCCATACAGATGAT pLKO.1 1131 CDS 100% 4.950 6.930 N Ptpn14 n/a
2 TRCN0000029016 CGGACAGATTCTGGTTGCTAT pLKO.1 3438 CDS 100% 4.950 3.960 N Ptpn14 n/a
3 TRCN0000356151 AGGCCACAAGATATCAGTATT pLKO_005 634 CDS 100% 13.200 9.240 N PTPN14 n/a
4 TRCN0000029015 GCCCACATGCTCAAGAACTAT pLKO.1 1965 CDS 100% 5.625 3.938 N Ptpn14 n/a
5 TRCN0000029014 GCAGTGATATACAGGTGGAAT pLKO.1 1044 CDS 100% 4.950 3.465 N Ptpn14 n/a
6 TRCN0000029018 GTTCACAGAATATGAGCAGAT pLKO.1 3032 CDS 100% 4.050 2.835 N Ptpn14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497131.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06815 pDONR223 100% 85.6% 91.4% None (many diffs) n/a
2 ccsbBroad304_06815 pLX_304 0% 85.6% 91.4% V5 (many diffs) n/a
3 TRCN0000479328 AGCCGCAAATCCCAATTCCCGTCC pLX_317 13.1% 85.6% 91.4% V5 (many diffs) n/a
Download CSV