Transcript: Mouse XM_006497323.1

PREDICTED: Mus musculus calcium channel, voltage-dependent, beta 2 subunit (Cacnb2), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cacnb2 (12296)
Length:
4521
CDS:
218..1786

Additional Resources:

NCBI RefSeq record:
XM_006497323.1
NBCI Gene record:
Cacnb2 (12296)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497323.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069104 GCAGGAATCATTTGATGTGAT pLKO.1 1108 CDS 100% 4.950 6.930 N Cacnb2 n/a
2 TRCN0000069103 CCAGTAAATCAGGAGGGAATT pLKO.1 396 CDS 100% 0.000 0.000 N Cacnb2 n/a
3 TRCN0000069105 CGAGTGGAACAGGGATGTATA pLKO.1 1753 CDS 100% 13.200 9.240 N Cacnb2 n/a
4 TRCN0000422085 ACAGATTTGAAGGGCGGATAT pLKO_005 735 CDS 100% 10.800 7.560 N CACNB2 n/a
5 TRCN0000069106 CCAAAGGAAGATTATTCACAT pLKO.1 1511 CDS 100% 4.950 3.465 N Cacnb2 n/a
6 TRCN0000069107 CCCAAGCTGAAGAAGAACCTT pLKO.1 1347 CDS 100% 3.000 2.100 N Cacnb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497323.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000475910 GCTCCATTGATGAATATAAACAAC pLX_317 14.6% 71.6% 74.7% V5 (many diffs) n/a
2 ccsbBroadEn_05924 pDONR223 100% 71.6% 74.5% None (many diffs) n/a
3 ccsbBroad304_05924 pLX_304 0% 71.6% 74.5% V5 (many diffs) n/a
Download CSV