Transcript: Mouse XM_006497604.2

PREDICTED: Mus musculus methyl-CpG binding domain protein 5 (Mbd5), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mbd5 (109241)
Length:
8214
CDS:
154..4983

Additional Resources:

NCBI RefSeq record:
XM_006497604.2
NBCI Gene record:
Mbd5 (109241)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497604.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253596 AGTGAATCAGAACCCTATTAT pLKO_005 900 CDS 100% 15.000 21.000 N Mbd5 n/a
2 TRCN0000253597 GTATGAACAAAGCGGTAAATG pLKO_005 5196 3UTR 100% 13.200 18.480 N Mbd5 n/a
3 TRCN0000253599 GGATATCCCTAACCCATTAAT pLKO_005 1353 CDS 100% 15.000 12.000 N Mbd5 n/a
4 TRCN0000295991 GGATATCCCTAACCCATTAAT pLKO_005 1353 CDS 100% 15.000 12.000 N MBD5 n/a
5 TRCN0000253600 CAGGTCTGCTTGGTGATATAT pLKO_005 3335 CDS 100% 15.000 10.500 N Mbd5 n/a
6 TRCN0000253598 CCTAAACCAGAATCTATTAAA pLKO_005 2610 CDS 100% 15.000 10.500 N Mbd5 n/a
7 TRCN0000038769 CGAGCAATGTTCCACCACAAA pLKO.1 769 CDS 100% 4.950 3.465 N MBD5 n/a
8 TRCN0000038772 GCCAAATCAAAGGACTGACTT pLKO.1 4670 CDS 100% 4.950 3.465 N MBD5 n/a
9 TRCN0000038771 CCCAAAGATCACGCTCATCTT pLKO.1 1166 CDS 100% 0.495 0.347 N MBD5 n/a
10 TRCN0000298783 CCCAAAGATCACGCTCATCTT pLKO_005 1166 CDS 100% 0.495 0.347 N MBD5 n/a
11 TRCN0000038773 GCTTGTCTGTTTCAGAACTTT pLKO.1 3535 CDS 100% 5.625 3.938 N MBD5 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7165 3UTR 100% 4.950 2.475 Y KAAG1 n/a
13 TRCN0000177808 CCTGGAACTTGCTATGTAGAT pLKO.1 7266 3UTR 100% 4.950 2.475 Y 2310022A10Rik n/a
14 TRCN0000286002 CCTGGAACTTGCTATGTAGAT pLKO_005 7266 3UTR 100% 4.950 2.475 Y 2310022A10Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497604.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12272 pDONR223 100% 13.4% 13.2% None (many diffs) n/a
2 ccsbBroad304_12272 pLX_304 0% 13.4% 13.2% V5 (many diffs) n/a
3 TRCN0000473566 CCTTGGAACCGATTTTTTGTAAAG pLX_317 67% 13.4% 13.2% V5 (many diffs) n/a
Download CSV