Transcript: Mouse XM_006497649.2

PREDICTED: Mus musculus dynamin 1 (Dnm1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dnm1 (13429)
Length:
3831
CDS:
131..2737

Additional Resources:

NCBI RefSeq record:
XM_006497649.2
NBCI Gene record:
Dnm1 (13429)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497649.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091698 CCTGCGACATTCTATAAATAT pLKO.1 3488 3UTR 100% 15.000 21.000 N Dnm1 n/a
2 TRCN0000381818 CTTATGCAGTTCGTCACTAAG pLKO_005 608 CDS 100% 10.800 15.120 N Dnm1 n/a
3 TRCN0000091702 GCTTATGCAGTTCGTCACTAA pLKO.1 607 CDS 100% 4.950 6.930 N Dnm1 n/a
4 TRCN0000091699 GCTCAGTATTATCGGCGACAT pLKO.1 2344 CDS 100% 4.050 5.670 N Dnm1 n/a
5 TRCN0000349422 GCTCAGTATTATCGGCGACAT pLKO_005 2344 CDS 100% 4.050 5.670 N Dnm1 n/a
6 TRCN0000313134 TCATGTCAAGCAAGCATATTT pLKO_005 1866 CDS 100% 15.000 12.000 N Dnm1 n/a
7 TRCN0000313136 CTCAGACTACCTGCTAGTTAC pLKO_005 3042 3UTR 100% 10.800 8.640 N Dnm1 n/a
8 TRCN0000091701 CTTCATGTCAAGCAAGCATAT pLKO.1 1864 CDS 100% 10.800 7.560 N Dnm1 n/a
9 TRCN0000381632 TCATGCTTCTCATCGACATTG pLKO_005 1554 CDS 100% 10.800 7.560 N Dnm1 n/a
10 TRCN0000313135 CTTGGCTGCAGAGCGCAAATT pLKO_005 883 CDS 100% 13.200 7.920 N Dnm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497649.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06106 pDONR223 100% 89.2% 95.3% None (many diffs) n/a
2 ccsbBroad304_06106 pLX_304 0% 89.2% 95.3% V5 (many diffs) n/a
3 TRCN0000476490 CAGTGACTTATCGTATTTGTCTGA pLX_317 13.3% 89.2% 95.3% V5 (many diffs) n/a
Download CSV