Transcript: Mouse XM_006497949.3

PREDICTED: Mus musculus proline-rich coiled-coil 2B (Prrc2b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prrc2b (227723)
Length:
10525
CDS:
125..6730

Additional Resources:

NCBI RefSeq record:
XM_006497949.3
NBCI Gene record:
Prrc2b (227723)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497949.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254299 TTCCACTTTGCCGACAGTAAA pLKO_005 6449 CDS 100% 13.200 18.480 N PRRC2B n/a
2 TRCN0000098966 GCCGACAGTAAACAGAATGTT pLKO.1 6458 CDS 100% 5.625 4.500 N Prrc2b n/a
3 TRCN0000098968 TCAGCCTGTTTGACAAGTATA pLKO.1 186 CDS 100% 13.200 9.240 N Prrc2b n/a
4 TRCN0000098967 CGCAGACCTCACACTAAAGAT pLKO.1 5590 CDS 100% 5.625 3.938 N Prrc2b n/a
5 TRCN0000098969 GCATCCTTCAGGACTGATGAA pLKO.1 2272 CDS 100% 4.950 3.465 N Prrc2b n/a
6 TRCN0000098965 GCCAGGAAATTGCATGTGAAA pLKO.1 8874 3UTR 100% 4.950 3.465 N Prrc2b n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7262 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497949.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12846 pDONR223 100% 13.2% 13.8% None (many diffs) n/a
2 ccsbBroad304_12846 pLX_304 0% 13.2% 13.8% V5 (many diffs) n/a
3 TRCN0000465640 AGGGGGGCCACCAGTTGCCTGAGG pLX_317 36% 13.2% 13.8% V5 (many diffs) n/a
Download CSV