Transcript: Mouse XM_006498555.1

PREDICTED: Mus musculus ER degradation enhancer, mannosidase alpha-like 2 (Edem2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Edem2 (108687)
Length:
1493
CDS:
510..1415

Additional Resources:

NCBI RefSeq record:
XM_006498555.1
NBCI Gene record:
Edem2 (108687)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498555.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431816 GCTCATCGAGAGCGCAATGTA pLKO_005 797 CDS 100% 5.625 7.875 N Edem2 n/a
2 TRCN0000126352 GTTCCACCCAAACAACTTCAT pLKO.1 1001 CDS 100% 4.950 6.930 N Edem2 n/a
3 TRCN0000126351 CGGAATTACACGCACTTCGAT pLKO.1 543 CDS 100% 3.000 4.200 N Edem2 n/a
4 TRCN0000126349 CCTGGCTGAAACTGTGAAATA pLKO.1 968 CDS 100% 13.200 10.560 N Edem2 n/a
5 TRCN0000426363 CCTCATAGCCACTGGATAATT pLKO_005 1408 CDS 100% 15.000 10.500 N Edem2 n/a
6 TRCN0000423603 GAACGCCTCTGTGTTCGAAAC pLKO_005 226 5UTR 100% 6.000 4.200 N Edem2 n/a
7 TRCN0000126353 GCTGCCAGAATTCTACAACAT pLKO.1 725 CDS 100% 0.000 0.000 N Edem2 n/a
8 TRCN0000126350 CCCAAACAACTTCATCCACAA pLKO.1 1007 CDS 100% 4.050 2.430 N Edem2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498555.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08575 pDONR223 100% 45.5% 47.1% None (many diffs) n/a
2 ccsbBroad304_08575 pLX_304 0% 45.5% 47.1% V5 (many diffs) n/a
3 TRCN0000467820 CCCCACCAGAACCCCCGATCTGTC pLX_317 17.2% 45.5% 47.1% V5 (many diffs) n/a
Download CSV