Transcript: Mouse XM_006498639.3

PREDICTED: Mus musculus catenin (cadherin associated protein), delta 1 (Ctnnd1), transcript variant X16, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ctnnd1 (12388)
Length:
5171
CDS:
462..3062

Additional Resources:

NCBI RefSeq record:
XM_006498639.3
NBCI Gene record:
Ctnnd1 (12388)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498639.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109413 CGAGGCTATGAACTCTTATTT pLKO.1 2118 CDS 100% 15.000 21.000 N Ctnnd1 n/a
2 TRCN0000332241 CGAGGCTATGAACTCTTATTT pLKO_005 2118 CDS 100% 15.000 21.000 N Ctnnd1 n/a
3 TRCN0000109414 CCCGATATTGGTAGGATTGTT pLKO.1 1388 CDS 100% 5.625 7.875 N Ctnnd1 n/a
4 TRCN0000354201 CCCGATATTGGTAGGATTGTT pLKO_005 1388 CDS 100% 5.625 7.875 N Ctnnd1 n/a
5 TRCN0000109412 GCTCGGAACAAAGAGTTAATT pLKO.1 2379 CDS 100% 15.000 12.000 N Ctnnd1 n/a
6 TRCN0000332237 GCTCGGAACAAAGAGTTAATT pLKO_005 2379 CDS 100% 15.000 12.000 N Ctnnd1 n/a
7 TRCN0000311514 GCTCCGAAAGGCTCGTGATAT pLKO_005 1535 CDS 100% 13.200 10.560 N Ctnnd1 n/a
8 TRCN0000311512 GCTGCCGTCATCCGTGAATTA pLKO_005 3205 3UTR 100% 13.200 9.240 N Ctnnd1 n/a
9 TRCN0000109410 CCCATCTCTCTTCGTCCTTTA pLKO.1 3982 3UTR 100% 10.800 7.560 N Ctnnd1 n/a
10 TRCN0000109411 CGACACTATGAAGATGGTTAT pLKO.1 801 CDS 100% 10.800 7.560 N Ctnnd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498639.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10760 pDONR223 100% 63.4% 68.2% None (many diffs) n/a
2 ccsbBroad304_10760 pLX_304 0% 63.4% 68.2% V5 (many diffs) n/a
3 TRCN0000466633 GGTACAGGGGAGCGGACCCTTTTA pLX_317 24.8% 63.4% 68.2% V5 (many diffs) n/a
Download CSV