Transcript: Mouse XM_006498824.3

PREDICTED: Mus musculus isocitrate dehydrogenase 3 (NAD+) beta (Idh3b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Idh3b (170718)
Length:
1320
CDS:
126..1268

Additional Resources:

NCBI RefSeq record:
XM_006498824.3
NBCI Gene record:
Idh3b (170718)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498824.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041394 CGGCATCTCAATCTTGAGTAT pLKO.1 1122 CDS 100% 4.950 3.960 N Idh3b n/a
2 TRCN0000287286 CGGCATCTCAATCTTGAGTAT pLKO_005 1122 CDS 100% 4.950 3.960 N Idh3b n/a
3 TRCN0000294724 CATCATTGGAAAGATCTATAC pLKO_005 452 CDS 100% 10.800 7.560 N Idh3b n/a
4 TRCN0000041396 CGTCCATAAAGCCAACATCAT pLKO.1 767 CDS 100% 4.950 3.465 N Idh3b n/a
5 TRCN0000041397 CCAATGGAGTATAAGGGTGAA pLKO.1 474 CDS 100% 4.050 2.835 N Idh3b n/a
6 TRCN0000041395 CCTGTGGAATTTAAGGAGCAT pLKO.1 351 CDS 100% 2.640 1.848 N Idh3b n/a
7 TRCN0000287344 CCTGTGGAATTTAAGGAGCAT pLKO_005 351 CDS 100% 2.640 1.848 N Idh3b n/a
8 TRCN0000294661 CCAATCTCTATGGCAACATAA pLKO_005 931 CDS 100% 13.200 7.920 N Idh3b n/a
9 TRCN0000220342 CCTTACCAGTTTGATGTGCTT pLKO.1 903 CDS 100% 2.640 1.848 N IDH3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498824.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00819 pDONR223 100% 85.9% 90.9% None (many diffs) n/a
2 ccsbBroad304_00819 pLX_304 0% 85.9% 90.9% V5 (many diffs) n/a
3 TRCN0000469293 GCAGACGGAGCGGCCAGCTGGTGA pLX_317 40.6% 85.9% 90.9% V5 (many diffs) n/a
Download CSV