Transcript: Mouse XM_006498990.3

PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, A (Ptpra), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptpra (19262)
Length:
2763
CDS:
90..2210

Additional Resources:

NCBI RefSeq record:
XM_006498990.3
NBCI Gene record:
Ptpra (19262)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498990.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029919 GTGTGATATTTGGGTTGATAT pLKO.1 2414 3UTR 100% 13.200 18.480 N Ptpra n/a
2 TRCN0000029920 CGGAACGCAAAGTGGATGTAT pLKO.1 1192 CDS 100% 5.625 7.875 N Ptpra n/a
3 TRCN0000029923 CAGGAGTACATTGACGCCTTT pLKO.1 2166 CDS 100% 4.050 5.670 N Ptpra n/a
4 TRCN0000367404 TCATCACTCAGTTCCACTTTA pLKO_005 997 CDS 100% 13.200 10.560 N PTPRA n/a
5 TRCN0000002837 GCCAACATGAAGAAGAACCGT pLKO.1 1470 CDS 100% 0.750 0.525 N PTPRA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498990.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06816 pDONR223 100% 80.7% 84.2% None (many diffs) n/a
2 ccsbBroad304_06816 pLX_304 0% 80.7% 84.2% V5 (many diffs) n/a
3 TRCN0000472631 CGCGTTCTGTTACATAAATGCCCC pLX_317 19.6% 80.7% 84.2% V5 (many diffs) n/a
Download CSV