Transcript: Mouse XM_006499025.3

PREDICTED: Mus musculus polymerase (RNA) I polypeptide B (Polr1b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Polr1b (20017)
Length:
3837
CDS:
93..3338

Additional Resources:

NCBI RefSeq record:
XM_006499025.3
NBCI Gene record:
Polr1b (20017)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499025.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111429 CCGTATGACCATAGGTATGTT pLKO.1 2696 CDS 100% 5.625 7.875 N Polr1b n/a
2 TRCN0000326604 CCGTATGACCATAGGTATGTT pLKO_005 2696 CDS 100% 5.625 7.875 N Polr1b n/a
3 TRCN0000111426 CCGTGCATGTATGATTTCTAT pLKO.1 2100 CDS 100% 5.625 7.875 N Polr1b n/a
4 TRCN0000326606 CCGTGCATGTATGATTTCTAT pLKO_005 2100 CDS 100% 5.625 7.875 N Polr1b n/a
5 TRCN0000111427 CGTGGTTTACTACAAGAGTAA pLKO.1 2441 CDS 100% 0.495 0.693 N Polr1b n/a
6 TRCN0000326539 CGTGGTTTACTACAAGAGTAA pLKO_005 2441 CDS 100% 0.495 0.693 N Polr1b n/a
7 TRCN0000111428 GCAGTCCAACACTGACAAGTT pLKO.1 1100 CDS 100% 4.950 3.465 N Polr1b n/a
8 TRCN0000111425 GCTGGTCTCAAACTCAGAAAT pLKO.1 3581 3UTR 100% 13.200 7.920 N Polr1b n/a
9 TRCN0000326605 GCTGGTCTCAAACTCAGAAAT pLKO_005 3581 3UTR 100% 13.200 7.920 N Polr1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499025.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14305 pDONR223 100% 74.4% 77.7% None (many diffs) n/a
2 ccsbBroad304_14305 pLX_304 0% 74.4% 77.7% V5 (many diffs) n/a
3 TRCN0000480108 CCACAAAGTCTCGAGAAGAACCGG pLX_317 9.2% 74.4% 77.7% V5 (many diffs) n/a
Download CSV