Transcript: Mouse XM_006499193.1

PREDICTED: Mus musculus tousled-like kinase 1 (Tlk1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tlk1 (228012)
Length:
3756
CDS:
525..2174

Additional Resources:

NCBI RefSeq record:
XM_006499193.1
NBCI Gene record:
Tlk1 (228012)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499193.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420733 GCCATAAGATCAGCGACTATT pLKO_005 301 5UTR 100% 13.200 18.480 N Tlk1 n/a
2 TRCN0000079013 GCGCTTTAATTGCTGCTAAAT pLKO.1 3117 3UTR 100% 13.200 18.480 N Tlk1 n/a
3 TRCN0000079014 GCGGCTTTAGTGAGGTCTATA pLKO.1 1267 CDS 100% 13.200 18.480 N Tlk1 n/a
4 TRCN0000079016 CGGTCTATTGTGATGCAGATT pLKO.1 1557 CDS 100% 4.950 6.930 N Tlk1 n/a
5 TRCN0000424881 GTGATCTCAGGCGGCAAATAG pLKO_005 613 CDS 100% 13.200 10.560 N Tlk1 n/a
6 TRCN0000079017 CGGCTTTAGTGAGGTCTATAA pLKO.1 1268 CDS 100% 13.200 9.240 N Tlk1 n/a
7 TRCN0000079015 CCCAGAATAGTTAAACTCTAT pLKO.1 1425 CDS 100% 4.950 3.465 N Tlk1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499193.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14947 pDONR223 0% 65.4% 70.4% None (many diffs) n/a
2 ccsbBroad304_14947 pLX_304 0% 65.4% 70.4% V5 (many diffs) n/a
3 TRCN0000480520 ACATAAGTTTACCCGAGAACGCGG pLX_317 14.1% 65.4% 70.4% V5 (many diffs) n/a
4 TRCN0000487936 ACAGCAAACCTACTCCTACTAAAT pLX_317 13% 65.4% 70.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV