Transcript: Mouse XM_006499458.3

PREDICTED: Mus musculus zinc finger protein 385B (Zfp385b), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp385b (241494)
Length:
5223
CDS:
2780..4090

Additional Resources:

NCBI RefSeq record:
XM_006499458.3
NBCI Gene record:
Zfp385b (241494)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499458.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174528 CGTAATGATCTGGCTTAGAAA pLKO.1 4381 3UTR 100% 5.625 4.500 N Zfp385b n/a
2 TRCN0000193684 CCCAAAGGATTCAGCAGTATA pLKO.1 4142 3UTR 100% 13.200 9.240 N Zfp385b n/a
3 TRCN0000116206 GCCCACTACAAAGGAAGTAAA pLKO.1 3197 CDS 100% 13.200 9.240 N ZNF385B n/a
4 TRCN0000193448 GTCAAGATTAAAGGTGCAGAA pLKO.1 3664 CDS 100% 4.050 2.835 N Zfp385b n/a
5 TRCN0000175354 CACACATTTGGAGTCTCCATT pLKO.1 3104 CDS 100% 4.950 2.970 N Zfp385b n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 28 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499458.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09677 pDONR223 100% 75.4% 79.4% None (many diffs) n/a
2 ccsbBroad304_09677 pLX_304 0% 75.4% 79.4% V5 (many diffs) n/a
3 TRCN0000470628 CATTGACGATGAAGAGCCGTGGAA pLX_317 40.3% 75.4% 79.4% V5 (many diffs) n/a
Download CSV