Transcript: Mouse XM_006499517.3

PREDICTED: Mus musculus Ral GTPase activating protein, alpha subunit 2 (catalytic) (Ralgapa2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ralgapa2 (241694)
Length:
6308
CDS:
326..6226

Additional Resources:

NCBI RefSeq record:
XM_006499517.3
NBCI Gene record:
Ralgapa2 (241694)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499517.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088099 CGTCAAGCATTACCTCATAAA pLKO.1 3985 CDS 100% 13.200 18.480 N Ralgapa2 n/a
2 TRCN0000088100 CCGAGCCAATCCAGTATCATT pLKO.1 4602 CDS 100% 5.625 7.875 N Ralgapa2 n/a
3 TRCN0000088101 CGAAGATCCATGCCAAAGTTT pLKO.1 3420 CDS 100% 5.625 3.938 N Ralgapa2 n/a
4 TRCN0000088098 CGGTGAAAGAACAGGAGGAAT pLKO.1 6192 CDS 100% 4.950 3.465 N Ralgapa2 n/a
5 TRCN0000088102 CCCAATGAAGAATCATATGTT pLKO.1 5896 CDS 100% 0.000 0.000 N Ralgapa2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499517.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14227 pDONR223 100% 11% 11.9% None (many diffs) n/a
2 ccsbBroad304_14227 pLX_304 0% 11% 11.9% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000467052 AACGGTAAACGTGCGTAGCCTCTG pLX_317 64.2% 11% 11.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV