Transcript: Mouse XM_006499599.1

PREDICTED: Mus musculus VPS39 HOPS complex subunit (Vps39), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vps39 (269338)
Length:
3064
CDS:
105..1628

Additional Resources:

NCBI RefSeq record:
XM_006499599.1
NBCI Gene record:
Vps39 (269338)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499599.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146521 CCAGCAAACACTCAGATCAAT pLKO.1 1341 CDS 100% 5.625 3.938 N VPS39 n/a
2 TRCN0000120895 CCACGTCTTGAAGGACACAAA pLKO.1 1097 CDS 100% 4.950 3.465 N Vps39 n/a
3 TRCN0000345239 CCACGTCTTGAAGGACACAAA pLKO_005 1097 CDS 100% 4.950 3.465 N Vps39 n/a
4 TRCN0000120892 CGCTGTTATGTTGCAGACAAT pLKO.1 1821 3UTR 100% 4.950 3.465 N Vps39 n/a
5 TRCN0000120893 GCCAGCAAACACTCAGATCAA pLKO.1 1340 CDS 100% 4.950 3.465 N Vps39 n/a
6 TRCN0000345310 GCCAGCAAACACTCAGATCAA pLKO_005 1340 CDS 100% 4.950 3.465 N Vps39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499599.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11723 pDONR223 100% 63.8% 67.9% None (many diffs) n/a
2 ccsbBroad304_11723 pLX_304 0% 63.8% 67.9% V5 (many diffs) n/a
3 TRCN0000480144 GCATTGTCAAAAATGCGGCATATC pLX_317 17.6% 63.8% 67.9% V5 (many diffs) n/a
4 ccsbBroadEn_02753 pDONR223 100% 52.3% 55.6% None (many diffs) n/a
5 ccsbBroad304_02753 pLX_304 0% 52.3% 55.6% V5 (many diffs) n/a
6 TRCN0000472102 CAATCTACATGATTAGCGGGCTCA pLX_317 19.4% 52.3% 55.6% V5 (many diffs) n/a
Download CSV