Transcript: Mouse XM_006499895.3

PREDICTED: Mus musculus dysbindin (dystrobrevin binding protein 1) domain containing 2 (Dbndd2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dbndd2 (52840)
Length:
3829
CDS:
369..845

Additional Resources:

NCBI RefSeq record:
XM_006499895.3
NBCI Gene record:
Dbndd2 (52840)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499895.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217585 GGGAACAGGATATGGTATAAA pLKO.1 1233 3UTR 100% 15.000 21.000 N Dbndd2 n/a
2 TRCN0000200083 CGCAGTCCAAATCCAAGTGAT pLKO.1 744 CDS 100% 4.950 3.960 N Dbndd2 n/a
3 TRCN0000177243 GAGTTTATTGATCTTGCGGAT pLKO.1 564 CDS 100% 2.160 1.728 N Dbndd2 n/a
4 TRCN0000178422 GACCTGACACTTTCCTTACTT pLKO.1 923 3UTR 100% 5.625 3.938 N Dbndd2 n/a
5 TRCN0000176934 GAGCAAGTGGAGTTTATTGAT pLKO.1 555 CDS 100% 5.625 3.938 N Dbndd2 n/a
6 TRCN0000176538 CAGAAGTTCTTTGAGGACATT pLKO.1 426 CDS 100% 4.950 3.465 N Dbndd2 n/a
7 TRCN0000198182 CTCGTCTATGGAAGTGAATGT pLKO.1 524 CDS 100% 4.950 3.465 N Dbndd2 n/a
8 TRCN0000182730 GCAGATGTGTTCTTGCCTTGT pLKO.1 594 CDS 100% 4.050 2.835 N Dbndd2 n/a
9 TRCN0000155668 CCAGAGACAGAGTTTGTCTTT pLKO.1 453 CDS 100% 0.495 0.347 N DBNDD2 n/a
10 TRCN0000343976 CCAGAGACAGAGTTTGTCTTT pLKO_005 453 CDS 100% 0.495 0.347 N DBNDD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499895.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08601 pDONR223 100% 84% 84.4% None (many diffs) n/a
2 ccsbBroad304_08601 pLX_304 0% 84% 84.4% V5 (many diffs) n/a
3 TRCN0000478588 GCATTTCCCTGGCCCAACACTCAG pLX_317 76.9% 84% 84.4% V5 (many diffs) n/a
Download CSV