Transcript: Mouse XM_006499907.3

PREDICTED: Mus musculus solute carrier family 23 (nucleobase transporters), member 2 (Slc23a2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc23a2 (54338)
Length:
6581
CDS:
462..2408

Additional Resources:

NCBI RefSeq record:
XM_006499907.3
NBCI Gene record:
Slc23a2 (54338)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499907.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070161 GCCGCCTATCCATGCAATAAA pLKO.1 1682 CDS 100% 15.000 21.000 N Slc23a2 n/a
2 TRCN0000350959 GAGGCGAAGCACTCGAATTTC pLKO_005 537 CDS 100% 13.200 18.480 N Slc23a2 n/a
3 TRCN0000338077 GCATTGCCATGCTGACGATTT pLKO_005 1267 CDS 100% 10.800 15.120 N Slc23a2 n/a
4 TRCN0000070159 GCCGGAGTTCAGACAAAGATT pLKO.1 2371 CDS 100% 5.625 7.875 N Slc23a2 n/a
5 TRCN0000070162 GCGAAGCACTCGAATTTCTTT pLKO.1 540 CDS 100% 5.625 7.875 N Slc23a2 n/a
6 TRCN0000070160 CCATCCTGTCTTTAGATAAAT pLKO.1 994 CDS 100% 15.000 10.500 N Slc23a2 n/a
7 TRCN0000350960 CTGTGTTCTTGATGGCATATT pLKO_005 1730 CDS 100% 13.200 9.240 N Slc23a2 n/a
8 TRCN0000370606 CTGTGTTCTTGATGGCATATT pLKO_005 1730 CDS 100% 13.200 9.240 N SLC23A2 n/a
9 TRCN0000350897 ACGGCATGGAGTCCTACAATC pLKO_005 2242 CDS 100% 10.800 7.560 N Slc23a2 n/a
10 TRCN0000338148 CCGTCGTAGCCAGTATCATTG pLKO_005 1612 CDS 100% 10.800 7.560 N Slc23a2 n/a
11 TRCN0000070158 CCCAATTTACAAATCCAAGAA pLKO.1 1337 CDS 100% 4.950 3.465 N Slc23a2 n/a
12 TRCN0000038207 CCTGTCTTTAGATAAATGGAA pLKO.1 998 CDS 100% 3.000 2.100 N SLC23A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499907.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11437 pDONR223 100% 57% 60.9% None (many diffs) n/a
2 ccsbBroad304_11437 pLX_304 0% 57% 60.9% V5 (many diffs) n/a
3 TRCN0000473960 ACAGGCCTCTTGCTCTGCATGTCT pLX_317 40% 57% 60.9% V5 (many diffs) n/a
Download CSV