Transcript: Mouse XM_006500693.2

PREDICTED: Mus musculus tumor protein D52-like 2 (Tpd52l2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tpd52l2 (66314)
Length:
2479
CDS:
205..897

Additional Resources:

NCBI RefSeq record:
XM_006500693.2
NBCI Gene record:
Tpd52l2 (66314)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500693.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313076 ATACACTTACCTAGGTAATAT pLKO_005 1292 3UTR 100% 15.000 21.000 N Tpd52l2 n/a
2 TRCN0000313077 AGGTGTGCTGTCTGACTTTAT pLKO_005 249 CDS 100% 13.200 9.240 N Tpd52l2 n/a
3 TRCN0000374557 GGCTGCCTTGGCATGAATTAG pLKO_005 1037 3UTR 100% 13.200 9.240 N Tpd52l2 n/a
4 TRCN0000087992 CTCGATAAGTATGCCTGTCAT pLKO.1 729 CDS 100% 4.950 3.465 N Tpd52l2 n/a
5 TRCN0000162138 CTTGGAGAGTGGAATGAGAAA pLKO.1 541 CDS 100% 4.950 3.465 N TPD52L2 n/a
6 TRCN0000087990 GACCTCTACAAGAAGACTCAA pLKO.1 574 CDS 100% 4.950 3.465 N Tpd52l2 n/a
7 TRCN0000312145 GACCTCTACAAGAAGACTCAA pLKO_005 574 CDS 100% 4.950 3.465 N Tpd52l2 n/a
8 TRCN0000087988 GCTGAAGAAGAGCACACCATT pLKO.1 2324 3UTR 100% 4.950 3.465 N Tpd52l2 n/a
9 TRCN0000159392 GACCATAAAGTCTAAGGTTGT pLKO.1 792 CDS 100% 4.050 2.835 N TPD52L2 n/a
10 TRCN0000280922 GACCATAAAGTCTAAGGTTGT pLKO_005 792 CDS 100% 4.050 2.835 N TPD52L2 n/a
11 TRCN0000087991 GCAGAGAGAATGGCAGCGATA pLKO.1 818 CDS 100% 4.050 2.835 N Tpd52l2 n/a
12 TRCN0000087989 GCCACCTTCAAGTCATTTGAA pLKO.1 760 CDS 100% 0.563 0.394 N Tpd52l2 n/a
13 TRCN0000312146 GCCACCTTCAAGTCATTTGAA pLKO_005 760 CDS 100% 0.563 0.394 N Tpd52l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500693.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01699 pDONR223 100% 79.3% 81.7% None (many diffs) n/a
2 ccsbBroad304_01699 pLX_304 0% 79.3% 81.7% V5 (many diffs) n/a
3 TRCN0000473459 ACACTAGGGGAACCTCTCCGGAAC pLX_317 79.9% 79.3% 81.7% V5 (many diffs) n/a
Download CSV